Transcript: Human XM_005254674.2

PREDICTED: Homo sapiens pseudopodium enriched atypical kinase 1 (PEAK1), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PEAK1 (79834)
Length:
11965
CDS:
725..5965

Additional Resources:

NCBI RefSeq record:
XM_005254674.2
NBCI Gene record:
PEAK1 (79834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088549 CCCTGTTAAGTCACCTAATTT pLKO.1 2473 CDS 100% 15.000 21.000 N Peak1 n/a
2 TRCN0000195001 CCCTGTTAAGTCACCTAATTT pLKO.1 2473 CDS 100% 15.000 21.000 N PEAK1 n/a
3 TRCN0000037443 CCACAAGTGTAATAAGCCATA pLKO.1 2694 CDS 100% 4.050 5.670 N PEAK1 n/a
4 TRCN0000333784 CCACAAGTGTAATAAGCCATA pLKO_005 2694 CDS 100% 4.050 5.670 N PEAK1 n/a
5 TRCN0000195688 CCTAAGCGCTGGATATCATTT pLKO.1 3488 CDS 100% 13.200 9.240 N PEAK1 n/a
6 TRCN0000196723 GCATAGAACATGTGCACATAA pLKO.1 8123 3UTR 100% 13.200 9.240 N PEAK1 n/a
7 TRCN0000197185 GAAGATCTCTTCCAGACTTTC pLKO.1 5738 CDS 100% 10.800 7.560 N PEAK1 n/a
8 TRCN0000199724 GCCATGTTCCTAAGCCTTATG pLKO.1 1104 CDS 100% 10.800 7.560 N PEAK1 n/a
9 TRCN0000037439 CCCATGAAGTAACAGAGGATT pLKO.1 3870 CDS 100% 4.950 3.465 N PEAK1 n/a
10 TRCN0000333785 CCCATGAAGTAACAGAGGATT pLKO_005 3870 CDS 100% 4.950 3.465 N PEAK1 n/a
11 TRCN0000037442 CCTCTAGTAATAATCAGGATA pLKO.1 1893 CDS 100% 4.950 3.465 N PEAK1 n/a
12 TRCN0000037441 CGGTTTACTATACTGCTTCAT pLKO.1 4746 CDS 100% 4.950 3.465 N PEAK1 n/a
13 TRCN0000333865 CGGTTTACTATACTGCTTCAT pLKO_005 4746 CDS 100% 4.950 3.465 N PEAK1 n/a
14 TRCN0000037440 CCCACTATGATAGTGGCAGAT pLKO.1 947 CDS 100% 0.405 0.284 N PEAK1 n/a
15 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 9748 3UTR 100% 4.950 2.475 Y GJD4 n/a
16 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 9748 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254674.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15152 pDONR223 17.6% 90.7% 6.2% None (many diffs) n/a
2 ccsbBroad304_15152 pLX_304 0% 90.7% 6.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491580 AATTGGATTGTCGATGTGTTGATT pLX_317 5.1% 90.7% 6.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV