Transcript: Human XM_005255332.4

PREDICTED: Homo sapiens NME/NM23 nucleoside diphosphate kinase 3 (NME3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NME3 (4832)
Length:
1037
CDS:
207..704

Additional Resources:

NCBI RefSeq record:
XM_005255332.4
NBCI Gene record:
NME3 (4832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255332.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199229 CGGCGCACACGAACGCACCTT pLKO.1 260 CDS 100% 0.000 0.000 N NME3 n/a
2 TRCN0000037747 CGAGAGGAAGGGCTTCAAGTT pLKO.1 341 CDS 100% 4.950 3.465 N NME3 n/a
3 TRCN0000289310 CGAGAGGAAGGGCTTCAAGTT pLKO_005 341 CDS 100% 4.950 3.465 N NME3 n/a
4 TRCN0000308113 TGGGCACTGGCTGTATGAGTA pLKO_005 687 CDS 100% 4.950 3.465 N NME3 n/a
5 TRCN0000356485 ACATCCACCTGTCTGGACGTT pLKO_005 825 3UTR 100% 2.640 1.848 N NME3 n/a
6 TRCN0000037746 GCCTTGTCAAGTATATGGCCT pLKO.1 445 CDS 100% 0.660 0.462 N NME3 n/a
7 TRCN0000289235 GCCTTGTCAAGTATATGGCCT pLKO_005 445 CDS 100% 0.660 0.462 N NME3 n/a
8 TRCN0000199320 CGCTGGGCACTGGCTGTATGA pLKO.1 684 CDS 100% 0.000 0.000 N NME3 n/a
9 TRCN0000037744 GCCTCTCCAATCCCTGGCGTA pLKO.1 864 3UTR 100% 0.000 0.000 N NME3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255332.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06644 pDONR223 100% 97.4% 75% None 282A>T;384_385insGTTGGCAA;495_496insTGAG n/a
2 ccsbBroad304_06644 pLX_304 0% 97.4% 75% V5 282A>T;384_385insGTTGGCAA;495_496insTGAG n/a
3 ccsbBroadEn_14716 pDONR223 0% 97.4% 75% None 282A>T;384_385insGTTGGCAA;495_496insTGAG n/a
4 ccsbBroad304_14716 pLX_304 0% 97.4% 75% V5 282A>T;384_385insGTTGGCAA;495_496insTGAG n/a
5 TRCN0000480572 GTATTGTACTGAACGTTCCGTGGC pLX_317 89.1% 97.4% 75% V5 282A>T;384_385insGTTGGCAA;495_496insTGAG n/a
6 TRCN0000488844 TGGCATACTGATATCATATGTGTA pLX_317 63.6% 97.4% 75% V5 (not translated due to prior stop codon) 282A>T;384_385insGTTGGCAA;495_496insTGAG n/a
Download CSV