Transcript: Human XM_005264519.5

PREDICTED: Homo sapiens striatin (STRN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STRN (6801)
Length:
5165
CDS:
145..2376

Additional Resources:

NCBI RefSeq record:
XM_005264519.5
NBCI Gene record:
STRN (6801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264519.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036944 GCCTGAGCGAATACAAGTTTA pLKO.1 2661 3UTR 100% 13.200 18.480 N STRN n/a
2 TRCN0000036948 GCAAGGGATATACAAGCATTT pLKO.1 1937 CDS 100% 10.800 15.120 N STRN n/a
3 TRCN0000036947 CGTCATTGATACTTCAACAAT pLKO.1 921 CDS 100% 5.625 7.875 N STRN n/a
4 TRCN0000374579 ACAAGATATGCTTGCTAATTT pLKO_005 1095 CDS 100% 15.000 10.500 N Strn n/a
5 TRCN0000419015 CAGATGGCACTCTGCGTTTAT pLKO_005 1799 CDS 100% 13.200 9.240 N STRN n/a
6 TRCN0000429946 GAAGTGGAAGCATTGACATTT pLKO_005 1216 CDS 100% 13.200 9.240 N STRN n/a
7 TRCN0000427130 TTGATGTAGAACCTATCTATA pLKO_005 1544 CDS 100% 13.200 9.240 N STRN n/a
8 TRCN0000036946 CCCACCTAGAAGCTGTTACAA pLKO.1 2144 CDS 100% 5.625 3.938 N STRN n/a
9 TRCN0000036945 GCGGTGAAGATCGAGATACAA pLKO.1 968 CDS 100% 5.625 3.938 N STRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264519.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11165 pDONR223 100% 98.3% 98.3% None 81_116del n/a
2 ccsbBroad304_11165 pLX_304 0% 98.3% 98.3% V5 81_116del n/a
3 TRCN0000478408 CATCACATATAAATGAGGACATGG pLX_317 14.7% 98.3% 98.3% V5 81_116del n/a
4 ccsbBroadEn_13744 pDONR223 100% 13.7% 10.7% None (many diffs) n/a
5 ccsbBroad304_13744 pLX_304 0% 13.7% 10.7% V5 (many diffs) n/a
6 TRCN0000478469 GAAAGTCCGTCCATTGTTCGGGAG pLX_317 74.3% 13.7% 10.7% V5 (many diffs) n/a
7 ccsbBroadEn_10409 pDONR223 100% 11% 9.8% None (many diffs) n/a
8 ccsbBroad304_10409 pLX_304 0% 11% 9.8% V5 (many diffs) n/a
9 TRCN0000466790 TCCCTAGAATGCAATACTATTATC pLX_317 100% 11% 9.8% V5 (many diffs) n/a
Download CSV