Transcript: Human XM_005264540.4

PREDICTED: Homo sapiens VRK serine/threonine kinase 2 (VRK2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VRK2 (7444)
Length:
3736
CDS:
246..1772

Additional Resources:

NCBI RefSeq record:
XM_005264540.4
NBCI Gene record:
VRK2 (7444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005264540.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276685 GTCCCAATGGGAACCACAAAC pLKO_005 826 CDS 100% 10.800 15.120 N Vrk2 n/a
2 TRCN0000010205 GCACACAATAGGTTAATCGAA pLKO.1 1308 CDS 100% 3.000 4.200 N VRK2 n/a
3 TRCN0000010208 ACCACAAACAGTATCAGGAAA pLKO.1 838 CDS 100% 4.950 3.960 N VRK2 n/a
4 TRCN0000196878 GCTCATAGTTTAGCATATGAT pLKO.1 1128 CDS 100% 0.000 0.000 N VRK2 n/a
5 TRCN0000196902 GATCTCCATCTTGGTATAAAT pLKO.1 1582 CDS 100% 15.000 10.500 N VRK2 n/a
6 TRCN0000010207 GTTGGATGTACTGGAATATAT pLKO.1 695 CDS 100% 15.000 10.500 N VRK2 n/a
7 TRCN0000342337 GTTGGATGTACTGGAATATAT pLKO_005 695 CDS 100% 15.000 10.500 N VRK2 n/a
8 TRCN0000195058 CTGGAGGATTTGGATTGATAT pLKO.1 355 CDS 100% 13.200 9.240 N VRK2 n/a
9 TRCN0000342262 CTGGAGGATTTGGATTGATAT pLKO_005 355 CDS 100% 13.200 9.240 N VRK2 n/a
10 TRCN0000195264 CACCGAAATGTTGTATTCTTA pLKO.1 1821 3UTR 100% 5.625 3.938 N VRK2 n/a
11 TRCN0000197178 GCTCTTCACCGAAATGTTGTA pLKO.1 1815 3UTR 100% 4.950 3.465 N VRK2 n/a
12 TRCN0000010204 GCCAAACTATCAAGCCCTCAA pLKO.1 1154 CDS 100% 4.050 2.835 N VRK2 n/a
13 TRCN0000342338 GCCAAACTATCAAGCCCTCAA pLKO_005 1154 CDS 100% 4.050 2.835 N VRK2 n/a
14 TRCN0000195115 CTTATTTCAGTGTTTCCTTCC pLKO.1 1838 3UTR 100% 2.250 1.575 N VRK2 n/a
15 TRCN0000199398 CAGGCCAGAATGGTACCTTTA pLKO.1 640 CDS 100% 0.000 0.000 N VRK2 n/a
16 TRCN0000010206 GGGAAGAAGTTACAGATTTAT pLKO.1 581 CDS 100% 15.000 9.000 N VRK2 n/a
17 TRCN0000342336 GGGAAGAAGTTACAGATTTAT pLKO_005 581 CDS 100% 15.000 9.000 N VRK2 n/a
18 TRCN0000276682 ATAATGGGACAATAGAGTTTA pLKO_005 874 CDS 100% 13.200 7.920 N Vrk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005264540.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489903 TCAGATCACACCCTGTTTGCAGGA pLX_317 24% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488806 TGAAGTCGAGCTTAGTCCGTATAA pLX_317 19.7% 99.8% 99.8% V5 (not translated due to prior stop codon) 1524_1525insTTG n/a
3 ccsbBroadEn_14877 pDONR223 100% 98.6% 48.3% None (many diffs) n/a
4 ccsbBroad304_14877 pLX_304 0% 98.6% 48.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000466532 GTCACTGTGTGTTCAAAAGAATTA pLX_317 23% 98.6% 48.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV