Transcript: Human XM_005273353.3

PREDICTED: Homo sapiens MAPK activated protein kinase 2 (MAPKAPK2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPKAPK2 (9261)
Length:
3133
CDS:
319..1434

Additional Resources:

NCBI RefSeq record:
XM_005273353.3
NBCI Gene record:
MAPKAPK2 (9261)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005273353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195312 CCGAGTTTATGAACCACCCTT pLKO.1 1268 CDS 100% 2.640 3.696 N MAPKAPK2 n/a
2 TRCN0000002285 CCAGCACTCGATTGTTGTAAA pLKO.1 3061 3UTR 100% 13.200 9.240 N MAPKAPK2 n/a
3 TRCN0000219652 TGGTTTGTTAGAGGGTATTTG pLKO.1 1918 3UTR 100% 13.200 9.240 N MAPKAPK2 n/a
4 TRCN0000002286 AGAAAGAGAAGCATCCGAAAT pLKO.1 795 CDS 100% 10.800 7.560 N MAPKAPK2 n/a
5 TRCN0000195074 CTGATTGTCATGGAATGTTTG pLKO.1 721 CDS 100% 10.800 7.560 N MAPKAPK2 n/a
6 TRCN0000219651 TCGTGGATGTGTACGAGAATC pLKO.1 677 CDS 100% 10.800 7.560 N MAPKAPK2 n/a
7 TRCN0000194963 CCATCCAGTATCTGCATTCAA pLKO.1 836 CDS 100% 5.625 3.938 N MAPKAPK2 n/a
8 TRCN0000002282 CTCTTTGACCACTCCTTGTTA pLKO.1 972 CDS 100% 5.625 3.938 N MAPKAPK2 n/a
9 TRCN0000002283 GACTACGAGCAGATCAAGATA pLKO.1 1461 3UTR 100% 5.625 3.938 N MAPKAPK2 n/a
10 TRCN0000002284 GCAATCAACAAAGGTCCCTCA pLKO.1 1296 CDS 100% 2.160 1.512 N MAPKAPK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005273353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489713 AGGCAGTCTCACCTTTAGTACACT pLX_317 30.7% 95.1% 95.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_07381 pDONR223 100% 90.2% 87.2% None (many diffs) n/a
3 ccsbBroad304_07381 pLX_304 0% 90.2% 87.2% V5 (many diffs) n/a
4 TRCN0000476256 ATCCGTGCATGCCAGTGTACTACA pLX_317 30.8% 90.2% 87.2% V5 (many diffs) n/a
5 ccsbBroadEn_14935 pDONR223 100% 85.8% 36.6% None (many diffs) n/a
6 ccsbBroad304_14935 pLX_304 0% 85.8% 36.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000470986 GCGGATCGTTTCACATTGGTTTGT pLX_317 36.2% 85.8% 36.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV