Transcript: Mouse XM_006497188.2

PREDICTED: Mus musculus dual specificity phosphatase 10 (Dusp10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dusp10 (63953)
Length:
2632
CDS:
83..1534

Additional Resources:

NCBI RefSeq record:
XM_006497188.2
NBCI Gene record:
Dusp10 (63953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314618 TCAAAGGCAAACGACCAATTA pLKO_005 1398 CDS 100% 13.200 18.480 N DUSP10 n/a
2 TRCN0000340403 ACGCTTACAAATTCGTCAAAG pLKO_005 1383 CDS 100% 10.800 15.120 N Dusp10 n/a
3 TRCN0000314619 GCTGCGAATCTGACGTATATG pLKO_005 245 CDS 100% 13.200 10.560 N DUSP10 n/a
4 TRCN0000081112 CCTTTGTTTAGACTCAAGCTA pLKO.1 154 CDS 100% 3.000 2.400 N Dusp10 n/a
5 TRCN0000220147 CAAAGGCAAACGACCAATTAT pLKO.1 1399 CDS 100% 15.000 10.500 N DUSP10 n/a
6 TRCN0000340326 CACCTTCCTCTGTACCATTAT pLKO_005 1154 CDS 100% 13.200 9.240 N Dusp10 n/a
7 TRCN0000340325 TGGTATTGCAGTTAGGTTAAA pLKO_005 1808 3UTR 100% 13.200 9.240 N Dusp10 n/a
8 TRCN0000314698 AGAACCTGCGGCAGTACTTTG pLKO_005 1227 CDS 100% 10.800 7.560 N DUSP10 n/a
9 TRCN0000340370 AGAACCTGCGGCAGTACTTTG pLKO_005 1227 CDS 100% 10.800 7.560 N Dusp10 n/a
10 TRCN0000375821 CACTGTCTTAGACTTGATTTC pLKO_005 715 CDS 100% 10.800 7.560 N Dusp10 n/a
11 TRCN0000081109 CCACATTAACTGTGCCGATAA pLKO.1 661 CDS 100% 10.800 7.560 N Dusp10 n/a
12 TRCN0000381833 CCACATTAACTGTGCCGATAA pLKO_005 661 CDS 100% 10.800 7.560 N DUSP10 n/a
13 TRCN0000375839 GAATTTGAGGAAGACCTAAAC pLKO_005 1454 CDS 100% 10.800 7.560 N Dusp10 n/a
14 TRCN0000081108 CGCTCTTCTTTCCTTTCCTTT pLKO.1 1605 3UTR 100% 4.950 3.465 N Dusp10 n/a
15 TRCN0000081110 CCTGGCAAAGAAGATGACCAA pLKO.1 547 CDS 100% 2.640 1.848 N Dusp10 n/a
16 TRCN0000081111 CGCCAAGAATCCTTACACCAA pLKO.1 1485 CDS 100% 2.640 1.848 N Dusp10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497188.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07774 pDONR223 100% 92.2% 96.4% None (many diffs) n/a
2 ccsbBroad304_07774 pLX_304 0% 92.2% 96.4% V5 (many diffs) n/a
3 TRCN0000469524 GCCGTAACAGCGCTCCTATAAATT pLX_317 26.3% 92.2% 96.4% V5 (many diffs) n/a
4 ccsbBroadEn_02648 pDONR223 100% 92% 96.4% None (many diffs) n/a
5 ccsbBroad304_02648 pLX_304 0% 92% 96.4% V5 (many diffs) n/a
6 TRCN0000479939 ACACAGGATGCCGTGCATAGTAGT pLX_317 26.3% 92% 96.4% V5 (many diffs) n/a
7 TRCN0000488962 GTTCGGAGAGGCTCTATGGTTGGG pLX_317 21.2% 92% 96.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV