Transcript: Mouse XM_006497785.2

PREDICTED: Mus musculus proteasome (prosome, macropain) subunit, beta type 7 (Psmb7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Psmb7 (19177)
Length:
662
CDS:
51..647

Additional Resources:

NCBI RefSeq record:
XM_006497785.2
NBCI Gene record:
Psmb7 (19177)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031760 GTAGATGTTACTGGACCTCAT pLKO.1 486 CDS 100% 4.050 3.240 N Psmb7 n/a
2 TRCN0000031759 GCTGTGTTTGAAGATAAGTTT pLKO.1 585 CDS 100% 5.625 3.938 N Psmb7 n/a
3 TRCN0000031761 GCAACTGAAGGGATGGTTGTT pLKO.1 237 CDS 100% 4.950 3.465 N Psmb7 n/a
4 TRCN0000003927 ACATTGGTGCAGCCCTAGTTT pLKO.1 457 CDS 100% 5.625 3.375 N PSMB7 n/a
5 TRCN0000315138 ACATTGGTGCAGCCCTAGTTT pLKO_005 457 CDS 100% 5.625 3.375 N PSMB7 n/a
6 TRCN0000003929 AGACACAGACATGACAACCCA pLKO.1 329 CDS 100% 0.750 0.450 N PSMB7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06800 pDONR223 100% 65.3% 68.5% None (many diffs) n/a
2 ccsbBroad304_06800 pLX_304 0% 65.3% 68.5% V5 (many diffs) n/a
3 TRCN0000492358 TAGACCGAACCGTCATTCCATTTT pLX_317 55.6% 65.3% 68.5% V5 (many diffs) n/a
Download CSV