Transcript: Mouse XM_006498085.3

PREDICTED: Mus musculus activin A receptor, type IC (Acvr1c), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Acvr1c (269275)
Length:
9596
CDS:
800..2131

Additional Resources:

NCBI RefSeq record:
XM_006498085.3
NBCI Gene record:
Acvr1c (269275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022607 CCAGTTGCCTTACTATGACAT pLKO.1 1891 CDS 100% 4.950 6.930 N Acvr1c n/a
2 TRCN0000022604 GCTCCCGAAATGCTTGATGAT pLKO.1 1757 CDS 100% 4.950 6.930 N Acvr1c n/a
3 TRCN0000360948 CTATTGCTCACCGAGATATAA pLKO_005 1602 CDS 100% 15.000 12.000 N Acvr1c n/a
4 TRCN0000360950 AGGGCTCCTTGTATGACTATT pLKO_005 1473 CDS 100% 13.200 10.560 N Acvr1c n/a
5 TRCN0000022606 GCAAGGACAATTGTACTTCAA pLKO.1 1223 CDS 100% 4.950 3.960 N Acvr1c n/a
6 TRCN0000022608 CGGAACTAAATGCTCAGGTCT pLKO.1 849 CDS 100% 2.640 2.112 N Acvr1c n/a
7 TRCN0000360897 AGTACCAGTTGCCTTACTATG pLKO_005 1887 CDS 100% 10.800 7.560 N Acvr1c n/a
8 TRCN0000360896 GCATGTAAAGATAACGCTAAA pLKO_005 2278 3UTR 100% 10.800 7.560 N Acvr1c n/a
9 TRCN0000022605 CCGAGATATAAAGTCAAAGAA pLKO.1 1612 CDS 100% 5.625 3.938 N Acvr1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498085.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09527 pDONR223 100% 77.3% 84.3% None (many diffs) n/a
2 ccsbBroad304_09527 pLX_304 0% 77.3% 84.3% V5 (many diffs) n/a
3 TRCN0000467652 ATGGGACCATTCACCGAGACTTCT pLX_317 27.2% 77.3% 84.3% V5 (many diffs) n/a
4 ccsbBroadEn_15242 pDONR223 0% 77.3% 84.3% None (many diffs) n/a
5 ccsbBroad304_15242 pLX_304 0% 77.3% 84.3% V5 (many diffs) n/a
6 TRCN0000471789 AGCTGTCCGCTATGTCACGACGAA pLX_317 24.5% 77.3% 84.3% V5 (many diffs) n/a
7 TRCN0000489072 TATATCTAAAAGCAAGACTTGTCC pLX_317 25.2% 77.3% 84.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000487772 AAAATCACCTCTCCTATTAATCCT pLX_317 18.8% 77.2% 84.2% V5 (many diffs) n/a
Download CSV