Transcript: Mouse XM_006498657.4

PREDICTED: Mus musculus casein kinase 2, alpha 1 polypeptide (Csnk2a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Csnk2a1 (12995)
Length:
4248
CDS:
301..1476

Additional Resources:

NCBI RefSeq record:
XM_006498657.4
NBCI Gene record:
Csnk2a1 (12995)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146603 AGACATTGTAAAAGACCCTG pXPR_003 TGG 310 26% 4 0.9558 Csnk2a1 CSNK2A1 76672
2 BRDN0001145349 GATTGATCATGAGCACAGAA pXPR_003 AGG 505 43% 7 0.4696 Csnk2a1 CSNK2A1 76674
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006498657.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222205 CCGAGTTGCTTCTCGATATTT pLKO.1 870 CDS 100% 15.000 21.000 N Csnk2a1 n/a
2 TRCN0000027627 GCCATCAACATCACAAATAAT pLKO.1 466 CDS 100% 15.000 21.000 N LOC245355 n/a
3 TRCN0000361110 TCCGAGTTGCTTCTCGATATT pLKO_005 869 CDS 100% 13.200 18.480 N Csnk2a1 n/a
4 TRCN0000222206 ACAGACTATGACATTCGATTT pLKO.1 685 CDS 100% 10.800 15.120 N Csnk2a1 n/a
5 TRCN0000361111 GCAATTGTACCAGACGTTAAC pLKO_005 666 CDS 100% 10.800 15.120 N Csnk2a1 n/a
6 TRCN0000195296 CGATTATAGTTTGGATATGTG pLKO.1 927 CDS 100% 4.950 3.960 N CSNK2A1 n/a
7 TRCN0000222204 GCCAATATGATGTCAGGGATT pLKO.1 1345 CDS 100% 4.050 3.240 N Csnk2a1 n/a
8 TRCN0000320928 ATTACCTGCAGGTGGAATATT pLKO_005 1732 3UTR 100% 15.000 10.500 N CSNK2A1 n/a
9 TRCN0000361116 ACCTGTCAGCAGCGCCAATAT pLKO_005 1332 CDS 100% 13.200 9.240 N Csnk2a1 n/a
10 TRCN0000222208 CAACACAGACTTCAAGCAATT pLKO.1 651 CDS 100% 10.800 7.560 N Csnk2a1 n/a
11 TRCN0000222207 CTGGACAAGCTGCTTCGATAT pLKO.1 1201 CDS 100% 10.800 7.560 N Csnk2a1 n/a
12 TRCN0000350294 TGGAATATTTCATGGACAAAT pLKO_005 1744 3UTR 100% 13.200 7.920 N CSNK2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006498657.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00381 pDONR223 100% 94.5% 98.7% None (many diffs) n/a
2 ccsbBroad304_00381 pLX_304 0% 94.5% 98.7% V5 (many diffs) n/a
3 TRCN0000481421 CCAGCAGAGCACTACACAGTGGCT pLX_317 38.4% 94.5% 98.7% V5 (many diffs) n/a
4 ccsbBroadEn_14604 pDONR223 0% 94.5% 98.7% None (many diffs) n/a
5 ccsbBroad304_14604 pLX_304 0% 94.5% 98.7% V5 (many diffs) n/a
6 TRCN0000475347 TATACTCCTGATCCTGCACCAGTC pLX_317 45% 94.5% 98.7% V5 (many diffs) n/a
7 TRCN0000489332 CTTAAACCGTTGGGACCTTGAGCT pLX_317 30.6% 94.5% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000491260 AAACCCATAGATCGAGCTTCCTTG pLX_317 25.2% 94.5% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489503 CGTCCTCGAGGCTAAGACATGATA pLX_317 37.1% 94.4% 98.4% V5 (many diffs) n/a
Download CSV