Transcript: Mouse XM_006500455.3

PREDICTED: Mus musculus N-acetyltransferase 10 (Nat10), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nat10 (98956)
Length:
4499
CDS:
1611..4337

Additional Resources:

NCBI RefSeq record:
XM_006500455.3
NBCI Gene record:
Nat10 (98956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444703 ATAACCTCCACACGCTGTTTG pLKO_005 2560 CDS 100% 10.800 15.120 N Nat10 n/a
2 TRCN0000446016 TCTCGGAACATGGTCGATTAC pLKO_005 4095 CDS 100% 10.800 15.120 N Nat10 n/a
3 TRCN0000184712 CCTCCAAGAGTCAATCCGATA pLKO.1 3002 CDS 100% 4.050 3.240 N Nat10 n/a
4 TRCN0000296411 TTGCTGTTCACCCAGATTATC pLKO_005 3496 CDS 100% 13.200 9.240 N NAT10 n/a
5 TRCN0000432460 GTATCAGGAGCATCTGGATTA pLKO_005 2612 CDS 100% 10.800 7.560 N Nat10 n/a
6 TRCN0000180802 GCTGGATTTGTTCCTGTCTAT pLKO.1 3786 CDS 100% 4.950 3.465 N Nat10 n/a
7 TRCN0000414401 AGAGTGGGACCTTGAACTTAA pLKO_005 1852 CDS 100% 13.200 7.920 N Nat10 n/a
8 TRCN0000184551 GCAGTGGAGAAGTGGCTTAAT pLKO.1 3036 CDS 100% 13.200 7.920 N Nat10 n/a
9 TRCN0000035700 CGAGCTGGATTTGTTCCTGTT pLKO.1 3783 CDS 100% 4.050 2.835 N NAT10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500455.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03554 pDONR223 100% 76.6% 80.7% None (many diffs) n/a
2 ccsbBroad304_03554 pLX_304 0% 76.6% 80.7% V5 (many diffs) n/a
3 TRCN0000467973 GCACGAATCGTCGTTATCGTATGG pLX_317 12.6% 76.6% 80.7% V5 (many diffs) n/a
4 TRCN0000489921 GGAAGCGGACCGCAAGTAAAATCC pLX_317 15.2% 76.6% 80.7% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489299 TGTGGATGATTATCAGCCCCGTGT pLX_317 12.7% 76.6% 80.6% V5 (many diffs) n/a
Download CSV