Transcript: Mouse XM_006501408.3

PREDICTED: Mus musculus S-adenosylhomocysteine hydrolase-like 1 (Ahcyl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ahcyl1 (229709)
Length:
3086
CDS:
459..1910

Additional Resources:

NCBI RefSeq record:
XM_006501408.3
NBCI Gene record:
Ahcyl1 (229709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350051 GGCCCAGACAGCGGTATTAAT pLKO_005 782 CDS 100% 15.000 21.000 N Ahcyl1 n/a
2 TRCN0000101595 GCCCAGAAAGTTGATTCTTTA pLKO.1 2153 3UTR 100% 13.200 18.480 N Ahcyl1 n/a
3 TRCN0000317932 GCCCAGAAAGTTGATTCTTTA pLKO_005 2153 3UTR 100% 13.200 18.480 N Ahcyl1 n/a
4 TRCN0000101599 GTTCACCAAATTCCCTACTAA pLKO.1 467 CDS 100% 5.625 4.500 N Ahcyl1 n/a
5 TRCN0000318001 GTTCACCAAATTCCCTACTAA pLKO_005 467 CDS 100% 5.625 4.500 N Ahcyl1 n/a
6 TRCN0000101596 CCTAAGAAGATGGATGAATAT pLKO.1 1770 CDS 100% 13.200 9.240 N Ahcyl1 n/a
7 TRCN0000314193 GAAGTATCCAAACGTGTTTAA pLKO_005 1034 CDS 100% 13.200 9.240 N Ahcyl1 n/a
8 TRCN0000101598 CAACATCTATTCAACTCAGAA pLKO.1 848 CDS 100% 4.950 3.465 N Ahcyl1 n/a
9 TRCN0000317931 CAACATCTATTCAACTCAGAA pLKO_005 848 CDS 100% 4.950 3.465 N Ahcyl1 n/a
10 TRCN0000051456 CAGCAGCAATTTCTGTGTGAA pLKO.1 620 CDS 100% 4.950 3.465 N AHCYL1 n/a
11 TRCN0000101597 GCTCTGATTTCACTCAGGAAA pLKO.1 702 CDS 100% 4.950 3.465 N Ahcyl1 n/a
12 TRCN0000051457 GATGTGATGTTTGGTGGGAAA pLKO.1 1233 CDS 100% 4.050 2.835 N AHCYL1 n/a
13 TRCN0000310439 GATGTGATGTTTGGTGGGAAA pLKO_005 1233 CDS 100% 4.050 2.835 N AHCYL1 n/a
14 TRCN0000051455 CCATCATTTGATGCCCACCTT pLKO.1 1809 CDS 100% 2.640 1.848 N AHCYL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11546 pDONR223 100% 90.1% 96.6% None (many diffs) n/a
2 ccsbBroad304_11546 pLX_304 0% 90.1% 96.6% V5 (many diffs) n/a
3 TRCN0000478243 TCTTTAAGGATATACCGATCACAC pLX_317 17.6% 90.1% 96.6% V5 (many diffs) n/a
4 ccsbBroadEn_02522 pDONR223 100% 85% 91.1% None (many diffs) n/a
5 ccsbBroad304_02522 pLX_304 0% 85% 91.1% V5 (many diffs) n/a
6 TRCN0000479541 CTCCGAGCAGCTAGTGTGTACACC pLX_317 23.3% 85% 91.1% V5 (many diffs) n/a
7 ccsbBroadEn_02757 pDONR223 100% 63.5% 73.3% None (many diffs) n/a
8 ccsbBroad304_02757 pLX_304 0% 63.5% 73.3% V5 (many diffs) n/a
9 TRCN0000481020 AAAGACACGACGTGGTCGTCTCCA pLX_317 22% 63.5% 73.3% V5 (many diffs) n/a
Download CSV