Transcript: Mouse XM_006503398.2

PREDICTED: Mus musculus MEIR1 treanscription regulator (Mier1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mier1 (71148)
Length:
4793
CDS:
57..1790

Additional Resources:

NCBI RefSeq record:
XM_006503398.2
NBCI Gene record:
Mier1 (71148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095737 CCCACGTCGATGTAAATATTT pLKO.1 698 CDS 100% 15.000 21.000 N Mier1 n/a
2 TRCN0000331339 ATCCGCCCACGTCGATGTAAA pLKO_005 693 CDS 100% 13.200 18.480 N MIER1 n/a
3 TRCN0000095735 GCCTTGAGAAGACTGAGATTT pLKO.1 1059 CDS 100% 13.200 9.240 N Mier1 n/a
4 TRCN0000095736 ACCAGGAGAAATACTAAACAA pLKO.1 1478 CDS 100% 5.625 3.938 N Mier1 n/a
5 TRCN0000095738 AGTTCTGAAATAGAGGATCTT pLKO.1 408 CDS 100% 4.950 3.465 N Mier1 n/a
6 TRCN0000095734 GCATTCTATTACATGTGGAAA pLKO.1 1224 CDS 100% 4.950 3.465 N Mier1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03845 pDONR223 100% 57.2% 57% None (many diffs) n/a
2 ccsbBroad304_03845 pLX_304 0% 57.2% 57% V5 (many diffs) n/a
3 TRCN0000476937 CTTTTGCCGTTTTACCGCAAAGCA pLX_317 40.1% 57.2% 57% V5 (many diffs) n/a
4 ccsbBroadEn_15952 pDONR223 0% 24.7% 26.1% None (many diffs) n/a
5 ccsbBroad304_15952 pLX_304 0% 24.7% 26.1% V5 (many diffs) n/a
6 TRCN0000480736 TATCGCCCGGGTTTCGGTTGCTCG pLX_317 94.8% 24.7% 26.1% V5 (many diffs) n/a
Download CSV