Transcript: Mouse XM_006507243.1

PREDICTED: Mus musculus aryl hydrocarbon receptor nuclear translocator 2 (Arnt2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arnt2 (11864)
Length:
6001
CDS:
126..2219

Additional Resources:

NCBI RefSeq record:
XM_006507243.1
NBCI Gene record:
Arnt2 (11864)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507243.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096379 CGCTATTATCATGCCATAGAT pLKO.1 2252 3UTR 100% 5.625 7.875 N Arnt2 n/a
2 TRCN0000323726 CGCTATTATCATGCCATAGAT pLKO_005 2252 3UTR 100% 5.625 7.875 N Arnt2 n/a
3 TRCN0000096383 GATGGTGAAGGTCCCAGTAAA pLKO.1 258 CDS 100% 13.200 9.240 N Arnt2 n/a
4 TRCN0000323728 GATGGTGAAGGTCCCAGTAAA pLKO_005 258 CDS 100% 13.200 9.240 N Arnt2 n/a
5 TRCN0000096380 CCACCTGCCTTTGAACAGAAT pLKO.1 827 CDS 100% 4.950 3.465 N Arnt2 n/a
6 TRCN0000323789 CCACCTGCCTTTGAACAGAAT pLKO_005 827 CDS 100% 4.950 3.465 N Arnt2 n/a
7 TRCN0000096382 CCTACTCTGATGAGATCGAGT pLKO.1 1348 CDS 100% 2.640 1.848 N Arnt2 n/a
8 TRCN0000323788 CCTACTCTGATGAGATCGAGT pLKO_005 1348 CDS 100% 2.640 1.848 N Arnt2 n/a
9 TRCN0000096381 GAATTGGATCAAGCCACCCTT pLKO.1 1861 CDS 100% 2.640 1.848 N Arnt2 n/a
10 TRCN0000374677 TGTCGGACAAGGCAGTAAATA pLKO_005 986 CDS 100% 15.000 9.000 N Arnt2 n/a
11 TRCN0000202079 CCTGTTTGTTTCACTGTGGGA pLKO.1 4962 3UTR 100% 0.660 0.330 Y Nkapl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507243.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11432 pDONR223 100% 84.1% 90.8% None (many diffs) n/a
2 ccsbBroad304_11432 pLX_304 0% 84.1% 90.8% V5 (many diffs) n/a
3 TRCN0000479506 GTGGTCCAAAGACGCTATTCAGCC pLX_317 13.6% 84.1% 90.8% V5 (many diffs) n/a
Download CSV