Transcript: Mouse XM_006507315.3

PREDICTED: Mus musculus C-terminal binding protein 2 (Ctbp2), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ctbp2 (13017)
Length:
2715
CDS:
416..1678

Additional Resources:

NCBI RefSeq record:
XM_006507315.3
NBCI Gene record:
Ctbp2 (13017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307495 TACGAAACTGTGTCAACAAAG pLKO_005 1398 CDS 100% 10.800 15.120 N Ctbp2 n/a
2 TRCN0000295115 CCCTGCAGGACTTGCTATATC pLKO_005 1023 CDS 100% 13.200 9.240 N Ctbp2 n/a
3 TRCN0000109338 CCTTTGGATTCAGCGTCATAT pLKO.1 942 CDS 100% 13.200 9.240 N Ctbp2 n/a
4 TRCN0000287705 CCTTTGGATTCAGCGTCATAT pLKO_005 942 CDS 100% 13.200 9.240 N Ctbp2 n/a
5 TRCN0000295114 ATTCGACAGTCTGCCACATTC pLKO_005 747 CDS 100% 10.800 7.560 N Ctbp2 n/a
6 TRCN0000109337 CCATTGAAGGATGCTCCAAAT pLKO.1 1265 CDS 100% 10.800 7.560 N Ctbp2 n/a
7 TRCN0000109335 CGGATGAATTTGATGGTCTTT pLKO.1 1733 3UTR 100% 4.950 3.465 N Ctbp2 n/a
8 TRCN0000287706 CGGATGAATTTGATGGTCTTT pLKO_005 1733 3UTR 100% 4.950 3.465 N Ctbp2 n/a
9 TRCN0000013744 GCCTTTGGATTCAGCGTCATA pLKO.1 941 CDS 100% 4.950 3.465 N CTBP2 n/a
10 TRCN0000273907 GCCTTTGGATTCAGCGTCATA pLKO_005 941 CDS 100% 4.950 3.465 N CTBP2 n/a
11 TRCN0000109336 CCCTACTTACAGGATGGGATA pLKO.1 971 CDS 100% 4.050 2.835 N Ctbp2 n/a
12 TRCN0000109339 GCCCTCAAGGAGGGCAGGATA pLKO.1 1190 CDS 100% 0.000 0.000 N Ctbp2 n/a
13 TRCN0000273846 TCGCATCCCAGAAAGCTTAAG pLKO_005 1381 CDS 100% 10.800 15.120 N CTBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507315.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15391 pDONR223 0% 84.1% 93.9% None (many diffs) n/a
2 ccsbBroad304_15391 pLX_304 0% 84.1% 93.9% V5 (many diffs) n/a
3 TRCN0000478688 GCTGGCTACGTTCAGGCTCCGTCT pLX_317 27.8% 84.1% 93.9% V5 (many diffs) n/a
4 ccsbBroadEn_10758 pDONR223 100% 72.9% 81.2% None (many diffs) n/a
5 ccsbBroad304_10758 pLX_304 0% 72.9% 81.2% V5 (many diffs) n/a
6 TRCN0000469969 TATCAGCAGTAACGCAGCTATGGG pLX_317 28.2% 72.9% 81.2% V5 (many diffs) n/a
Download CSV