Transcript: Mouse XM_006507597.3

PREDICTED: Mus musculus phosphatidylinositol binding clathrin assembly protein (Picalm), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Picalm (233489)
Length:
3751
CDS:
354..2390

Additional Resources:

NCBI RefSeq record:
XM_006507597.3
NBCI Gene record:
Picalm (233489)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507597.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379479 CCAAACTTCCGCCTAACAAAT pLKO_005 1936 CDS 100% 13.200 18.480 N Picalm n/a
2 TRCN0000313319 GACGGTATAGTAGATACTTAA pLKO_005 727 CDS 100% 13.200 18.480 N Picalm n/a
3 TRCN0000113185 GCGTTGTCAATACCACTTATA pLKO.1 2577 3UTR 100% 13.200 18.480 N Picalm n/a
4 TRCN0000312362 GCGTTGTCAATACCACTTATA pLKO_005 2577 3UTR 100% 13.200 18.480 N Picalm n/a
5 TRCN0000113189 CCACTAAGAATGATGTAAGTT pLKO.1 2023 CDS 100% 5.625 7.875 N Picalm n/a
6 TRCN0000230156 GCACCAGCCATTGACATATTT pLKO_005 1464 CDS 100% 15.000 12.000 N PICALM n/a
7 TRCN0000313326 GCACCAGCCATTGACATATTT pLKO_005 1464 CDS 100% 15.000 12.000 N Picalm n/a
8 TRCN0000113186 GCAGCATACAATGAAGGAATT pLKO.1 978 CDS 100% 0.000 0.000 N Picalm n/a
9 TRCN0000380220 ATTAAAGGAACAGCGTCTAAA pLKO_005 1364 CDS 100% 13.200 9.240 N Picalm n/a
10 TRCN0000313320 TGGATTGCAAGGATATGATAT pLKO_005 692 CDS 100% 13.200 9.240 N Picalm n/a
11 TRCN0000119072 GCCTTAATGTTGACTTTGAAT pLKO.1 1804 CDS 100% 5.625 3.938 N PICALM n/a
12 TRCN0000113188 GCTTCAAGAAACACATTGTTT pLKO.1 645 CDS 100% 5.625 3.938 N Picalm n/a
13 TRCN0000312300 GCTTCAAGAAACACATTGTTT pLKO_005 645 CDS 100% 5.625 3.938 N Picalm n/a
14 TRCN0000113187 CGGGCATGATAGGATATGGAA pLKO.1 2170 CDS 100% 3.000 2.100 N Picalm n/a
15 TRCN0000379934 ACTCATTACAACTCATCATTT pLKO_005 587 CDS 100% 13.200 7.920 N Picalm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507597.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01884 pDONR223 100% 82.6% 85.5% None (many diffs) n/a
2 ccsbBroad304_01884 pLX_304 0% 82.6% 85.5% V5 (many diffs) n/a
3 TRCN0000480673 ATGGTAAACCCTCTATTCGATGTC pLX_317 18.6% 82.6% 85.5% V5 (many diffs) n/a
Download CSV