Transcript: Mouse XM_006510230.3

PREDICTED: Mus musculus Myb/SANT-like DNA-binding domain containing 2 (Msantd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msantd2 (235184)
Length:
5642
CDS:
1284..3071

Additional Resources:

NCBI RefSeq record:
XM_006510230.3
NBCI Gene record:
Msantd2 (235184)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085208 GCCTTGATATAAGCAAATGTA pLKO.1 3336 3UTR 100% 5.625 7.875 N Msantd2 n/a
2 TRCN0000301975 GCCTTGATATAAGCAAATGTA pLKO_005 3336 3UTR 100% 5.625 7.875 N Msantd2 n/a
3 TRCN0000085211 CGAGATACCATGCAGAATATT pLKO.1 2223 CDS 100% 15.000 10.500 N Msantd2 n/a
4 TRCN0000301910 CGAGATACCATGCAGAATATT pLKO_005 2223 CDS 100% 15.000 10.500 N Msantd2 n/a
5 TRCN0000017119 GCAGCACTATGGAGGACTATT pLKO.1 2074 CDS 100% 13.200 9.240 N MSANTD2 n/a
6 TRCN0000085212 GCGAGATACCATGCAGAATAT pLKO.1 2222 CDS 100% 13.200 9.240 N Msantd2 n/a
7 TRCN0000017120 CCATTGGCTATGAAGAATGTA pLKO.1 2662 CDS 100% 5.625 3.938 N MSANTD2 n/a
8 TRCN0000085210 GCTATCCAACAGATCAGGAAT pLKO.1 2134 CDS 100% 4.950 3.465 N Msantd2 n/a
9 TRCN0000301911 GCTATCCAACAGATCAGGAAT pLKO_005 2134 CDS 100% 4.950 3.465 N Msantd2 n/a
10 TRCN0000085209 GCAGTTGAAATGGGAACTGTT pLKO.1 2264 CDS 100% 0.495 0.347 N Msantd2 n/a
11 TRCN0000301998 GCAGTTGAAATGGGAACTGTT pLKO_005 2264 CDS 100% 0.495 0.347 N Msantd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14266 pDONR223 100% 72.7% 75.8% None (many diffs) n/a
2 ccsbBroad304_14266 pLX_304 0% 72.7% 75.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475954 TCCGCCCATTTTGTACGGACGAGC pLX_317 6.4% 72.7% 75.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV