Transcript: Mouse XM_006511459.2

PREDICTED: Mus musculus F-box protein 22 (Fbxo22), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo22 (71999)
Length:
4138
CDS:
2463..3362

Additional Resources:

NCBI RefSeq record:
XM_006511459.2
NBCI Gene record:
Fbxo22 (71999)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004309 GTAGCAATCGACCTCAGGAAA pLKO.1 2632 CDS 100% 4.950 6.930 N FBXO22 n/a
2 TRCN0000175683 GAGGTCACTTTGGGATGATTT pLKO.1 3496 3UTR 100% 13.200 10.560 N Fbxo22 n/a
3 TRCN0000320040 GAGGTCACTTTGGGATGATTT pLKO_005 3496 3UTR 100% 13.200 10.560 N Fbxo22 n/a
4 TRCN0000175100 GCACTTTCAGCGATATGAATA pLKO.1 2872 CDS 100% 13.200 10.560 N Fbxo22 n/a
5 TRCN0000319961 GCACTTTCAGCGATATGAATA pLKO_005 2872 CDS 100% 13.200 10.560 N Fbxo22 n/a
6 TRCN0000216970 CGACCTCAGGAAATAGAAATT pLKO.1 2640 CDS 100% 13.200 9.240 N Fbxo22 n/a
7 TRCN0000215784 CTTTATTATTCCCTCAAATTG pLKO.1 2677 CDS 100% 13.200 9.240 N Fbxo22 n/a
8 TRCN0000216836 GAGAAGAACCCTCTGGATATT pLKO.1 2940 CDS 100% 13.200 9.240 N Fbxo22 n/a
9 TRCN0000193477 GAGGAGATGTAATGAGGTAAA pLKO.1 3275 CDS 100% 10.800 7.560 N Fbxo22 n/a
10 TRCN0000319962 GAGGAGATGTAATGAGGTAAA pLKO_005 3275 CDS 100% 10.800 7.560 N Fbxo22 n/a
11 TRCN0000193737 CCATAGCTACACAACCATCAT pLKO.1 3311 CDS 100% 4.950 3.465 N Fbxo22 n/a
12 TRCN0000319963 CCATAGCTACACAACCATCAT pLKO_005 3311 CDS 100% 4.950 3.465 N Fbxo22 n/a
13 TRCN0000176410 CTGAGGAGATGTAATGAGGTA pLKO.1 3273 CDS 100% 2.640 1.848 N Fbxo22 n/a
14 TRCN0000004308 CTTCGTGTGGTCCTTGTCTTT pLKO.1 2799 CDS 100% 4.950 2.970 N FBXO22 n/a
15 TRCN0000075853 GCCTGGTCTATAGAGTGAGTT pLKO.1 3813 3UTR 100% 4.950 2.475 Y Oasl2 n/a
16 TRCN0000194517 GCCTGGTCTATAGAGTGAGTT pLKO.1 3813 3UTR 100% 4.950 2.475 Y Fbxo22 n/a
17 TRCN0000317452 GCCTGGTCTATAGAGTGAGTT pLKO_005 3813 3UTR 100% 4.950 2.475 Y Oasl2 n/a
18 TRCN0000010869 GTGTGGTCCTTGTCTTTGGTT pLKO.1 2803 CDS 100% 3.000 2.100 N FBXO22 n/a
19 TRCN0000166364 CACACACACACACACACACAA pLKO.1 801 5UTR 100% 4.950 2.475 Y KAAG1 n/a
20 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 3774 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08009 pDONR223 100% 66.5% 69.7% None (many diffs) n/a
2 ccsbBroad304_08009 pLX_304 0% 66.5% 69.7% V5 (many diffs) n/a
3 TRCN0000468178 GGCGTTCTCATGGAACCTGAAACC pLX_317 32.8% 66.5% 69.7% V5 (many diffs) n/a
Download CSV