Transcript: Mouse XM_006514444.1

PREDICTED: Mus musculus glucokinase (Gck), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gck (103988)
Length:
2874
CDS:
478..1941

Additional Resources:

NCBI RefSeq record:
XM_006514444.1
NBCI Gene record:
Gck (103988)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006514444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012399 GCTACTATGAAGACCGCCAAT pLKO.1 1115 CDS 100% 4.050 5.670 N Gck n/a
2 TRCN0000012398 CCAGAGACAGTCTCCTTCATA pLKO.1 2535 3UTR 100% 5.625 3.938 N Gck n/a
3 TRCN0000012402 CAACTGCGAAATCACCTTCAT pLKO.1 1918 CDS 100% 4.950 3.465 N Gck n/a
4 TRCN0000195412 CCTGGACAAGCATCAGATGAA pLKO.1 876 CDS 100% 4.950 3.465 N GCK n/a
5 TRCN0000012400 GCATCAGATGAAACACAAGAA pLKO.1 885 CDS 100% 4.950 3.465 N Gck n/a
6 TRCN0000199354 CGTGGATGGCTCCGTGTACAA pLKO.1 1698 CDS 100% 1.650 1.155 N GCK n/a
7 TRCN0000012401 GTTGGAGACTTTCTCTCCTTA pLKO.1 688 CDS 100% 0.495 0.347 N Gck n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006514444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00624 pDONR223 100% 76.2% 84.1% None (many diffs) n/a
2 ccsbBroad304_00624 pLX_304 0% 76.2% 84.1% V5 (many diffs) n/a
3 TRCN0000468306 GCGATAACTTATGCTACTCCATAT pLX_317 31.6% 76.2% 84.1% V5 (many diffs) n/a
4 ccsbBroadEn_14654 pDONR223 0% 76.2% 84.1% None (many diffs) n/a
5 ccsbBroad304_14654 pLX_304 0% 76.2% 84.1% V5 (many diffs) n/a
6 TRCN0000480104 TCCTATTCACCTTTCACATAAAAC pLX_317 25.5% 76.2% 84.1% V5 (many diffs) n/a
7 TRCN0000489651 ACAGAGTAGCGGTATCCGCCCAAT pLX_317 25.1% 76.2% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489668 TGCTACGCCATCCATTGTTCTGGC pLX_317 24.9% 76.2% 84.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489255 TCACTGTGAAGAAGTACTGAATTT pLX_317 28.6% 76.2% 84.1% V5 (many diffs) n/a
Download CSV