Transcript: Mouse XM_006515523.3

PREDICTED: Mus musculus Max protein (Max), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Max (17187)
Length:
1951
CDS:
280..654

Additional Resources:

NCBI RefSeq record:
XM_006515523.3
NBCI Gene record:
Max (17187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515523.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042714 GCAACAGAGTATATCCAGTAT pLKO.1 370 CDS 100% 4.950 3.960 N Max n/a
2 TRCN0000315984 GCAACAGAGTATATCCAGTAT pLKO_005 370 CDS 100% 4.950 3.960 N Max n/a
3 TRCN0000304478 CCCTCCTTTGTAAGGATTATT pLKO_005 1125 3UTR 100% 15.000 10.500 N Max n/a
4 TRCN0000374152 ACCATTGAGAAGACTCTTTAT pLKO_005 734 3UTR 100% 13.200 9.240 N Max n/a
5 TRCN0000257324 ACGAAGAGCAACCGAGGTTTC pLKO_005 314 CDS 100% 6.000 4.200 N MAX n/a
6 TRCN0000042717 CACTGGAGAAGGCAAGATCAA pLKO.1 473 CDS 100% 4.950 3.465 N Max n/a
7 TRCN0000374209 TGCCCAACTGCAGACCAACTA pLKO_005 495 CDS 100% 4.950 3.465 N Max n/a
8 TRCN0000042715 CCCAAATCCTAGACAAAGCAA pLKO.1 353 CDS 100% 3.000 2.100 N Max n/a
9 TRCN0000316020 CCCAAATCCTAGACAAAGCAA pLKO_005 353 CDS 100% 3.000 2.100 N Max n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515523.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15495 pDONR223 0% 76.6% 76.1% None (many diffs) n/a
2 ccsbBroad304_15495 pLX_304 0% 76.6% 76.1% V5 (many diffs) n/a
3 TRCN0000468720 GTCTTCCACGTTCCTTTAATGCAG pLX_317 73.3% 76.6% 76.1% V5 (many diffs) n/a
4 ccsbBroadEn_15494 pDONR223 0% 76.4% 75.4% None (many diffs) n/a
5 ccsbBroad304_15494 pLX_304 0% 76.4% 75.4% V5 (many diffs) n/a
6 TRCN0000469052 TCAGTACTAGGAAGGTCTCTACGA pLX_317 74.2% 76.4% 75.4% V5 (many diffs) n/a
7 ccsbBroadEn_00978 pDONR223 100% 73.9% 76.8% None (many diffs) n/a
8 ccsbBroad304_00978 pLX_304 0% 73.9% 76.8% V5 (many diffs) n/a
9 TRCN0000467427 CCTTCTTCGGGGACGGAAGTTACA pLX_317 69.4% 73.9% 76.8% V5 (many diffs) n/a
10 ccsbBroadEn_06564 pDONR223 100% 52.2% 38.2% None (many diffs) n/a
11 ccsbBroad304_06564 pLX_304 0% 52.2% 38.2% V5 (many diffs) n/a
12 TRCN0000473082 TAAATTTTGTCTGCTATTGACACA pLX_317 100% 52.2% 38.2% V5 (many diffs) n/a
Download CSV