Transcript: Mouse XM_006518882.3

PREDICTED: Mus musculus homeobox containing 1 (Hmbox1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hmbox1 (219150)
Length:
7277
CDS:
386..1720

Additional Resources:

NCBI RefSeq record:
XM_006518882.3
NBCI Gene record:
Hmbox1 (219150)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518882.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015009 CCGATGGTATCAACTTGAGAA pLKO.1 1051 CDS 100% 4.950 6.930 N HMBOX1 n/a
2 TRCN0000273599 GAAAGTGCTTCCAGGTATTTA pLKO_005 1996 3UTR 100% 15.000 12.000 N HMBOX1 n/a
3 TRCN0000085934 CGGGATGACCAAACATGAAAT pLKO.1 493 CDS 100% 13.200 9.240 N Hmbox1 n/a
4 TRCN0000331771 CGGGATGACCAAACATGAAAT pLKO_005 493 CDS 100% 13.200 9.240 N Hmbox1 n/a
5 TRCN0000085937 GCCTAGCTGTCATGGAAAGTT pLKO.1 1218 CDS 100% 5.625 3.938 N Hmbox1 n/a
6 TRCN0000301801 GCCTAGCTGTCATGGAAAGTT pLKO_005 1218 CDS 100% 5.625 3.938 N Hmbox1 n/a
7 TRCN0000085936 GAGTAGATTTACCTGGAGAAA pLKO.1 1192 CDS 100% 4.950 3.465 N Hmbox1 n/a
8 TRCN0000301802 GAGTAGATTTACCTGGAGAAA pLKO_005 1192 CDS 100% 4.950 3.465 N Hmbox1 n/a
9 TRCN0000085935 GCTGGAAACCATGTCTCACTA pLKO.1 412 CDS 100% 4.950 3.465 N Hmbox1 n/a
10 TRCN0000301803 GCTGGAAACCATGTCTCACTA pLKO_005 412 CDS 100% 4.950 3.465 N Hmbox1 n/a
11 TRCN0000085933 CCCAGAGTCATTAGGACTCTT pLKO.1 2713 3UTR 100% 0.495 0.347 N Hmbox1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518882.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12575 pDONR223 100% 64.6% 66.8% None (many diffs) n/a
2 ccsbBroad304_12575 pLX_304 0% 64.6% 66.8% V5 (many diffs) n/a
3 TRCN0000472482 AATTTAAAATGATCCCAGGCATCA pLX_317 44.4% 64.6% 66.8% V5 (many diffs) n/a
Download CSV