Transcript: Mouse XM_006521065.3

PREDICTED: Mus musculus sulfotransferase family 4A, member 1 (Sult4a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sult4a1 (29859)
Length:
2507
CDS:
151..993

Additional Resources:

NCBI RefSeq record:
XM_006521065.3
NBCI Gene record:
Sult4a1 (29859)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103352 CCCTGATGAAATCGGCCTGAT pLKO.1 369 CDS 100% 4.050 5.670 N Sult4a1 n/a
2 TRCN0000103350 CGGAGATCAAAGAACGGGTTT pLKO.1 1576 3UTR 100% 4.050 5.670 N Sult4a1 n/a
3 TRCN0000103351 CCAAGGACTTGGTGGTATCTT pLKO.1 554 CDS 100% 5.625 3.938 N Sult4a1 n/a
4 TRCN0000103353 CGAGTTCGAGAGCAAGTACTT pLKO.1 189 CDS 100% 4.950 3.465 N Sult4a1 n/a
5 TRCN0000103354 CGGAGGTTCATGAATGACAAA pLKO.1 637 CDS 100% 4.950 3.465 N Sult4a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521065.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11771 pDONR223 100% 84.4% 88.9% None (many diffs) n/a
2 ccsbBroad304_11771 pLX_304 0% 84.4% 88.9% V5 (many diffs) n/a
3 TRCN0000473443 TTTCTGCTCTAGGACCTTCAATGA pLX_317 43.2% 84.4% 88.9% V5 (many diffs) n/a
4 ccsbBroadEn_07948 pDONR223 100% 81% 80.5% None (many diffs) n/a
5 ccsbBroad304_07948 pLX_304 0% 81% 80.5% V5 (many diffs) n/a
6 ccsbBroadEn_15772 pDONR223 0% 80.7% 80.1% None (many diffs) n/a
7 ccsbBroad304_15772 pLX_304 0% 80.7% 80.1% V5 (many diffs) n/a
8 TRCN0000470668 CCACGCCACATGCTCTAAGAGTAT pLX_317 19.6% 80.7% 80.1% V5 (many diffs) n/a
Download CSV