Transcript: Mouse XM_006521587.2

PREDICTED: Mus musculus RNA binding protein, fox-1 homolog (C. elegans) 2 (Rbfox2), transcript variant X23, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbfox2 (93686)
Length:
6954
CDS:
538..1782

Additional Resources:

NCBI RefSeq record:
XM_006521587.2
NBCI Gene record:
Rbfox2 (93686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102343 CGACTACATGTCTCTAATATT pLKO.1 1075 CDS 100% 15.000 10.500 N Rbfox2 n/a
2 TRCN0000102340 GCCATTAAAGAGTGTGTAGAA pLKO.1 2839 3UTR 100% 4.950 3.465 N Rbfox2 n/a
3 TRCN0000102344 GCTGTGTATGGTCCTGAGTTA pLKO.1 1279 CDS 100% 4.950 3.465 N Rbfox2 n/a
4 TRCN0000074543 CCTCACTATGTTCTTTGAATA pLKO.1 1915 3UTR 100% 13.200 7.920 N RBFOX2 n/a
5 TRCN0000306861 TTGGCGCTGTGGCGAGTTTAT pLKO_005 1727 CDS 100% 13.200 18.480 N RBFOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11745 pDONR223 100% 70.9% 72.3% None (many diffs) n/a
2 ccsbBroad304_11745 pLX_304 0% 70.9% 72.3% V5 (many diffs) n/a
3 TRCN0000478244 AAGGTTCGACCCGCACGGCTGATA pLX_317 24.7% 70.9% 72.3% V5 (many diffs) n/a
4 ccsbBroadEn_02790 pDONR223 100% 69.6% 71.9% None (many diffs) n/a
5 ccsbBroad304_02790 pLX_304 0% 69.6% 71.9% V5 (many diffs) n/a
Download CSV