Transcript: Mouse XM_006524922.2

PREDICTED: Mus musculus PTK7 protein tyrosine kinase 7 (Ptk7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptk7 (71461)
Length:
4089
CDS:
16..3222

Additional Resources:

NCBI RefSeq record:
XM_006524922.2
NBCI Gene record:
Ptk7 (71461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361798 CCCAAGCCGCTATCGTCTTTA pLKO_005 92 CDS 100% 13.200 18.480 N Ptk7 n/a
2 TRCN0000368807 AGCGGCGACAGGATGTCAATA pLKO_005 1205 CDS 100% 13.200 10.560 N Ptk7 n/a
3 TRCN0000361795 TACTGCAAGAAGCGGTGTAAA pLKO_005 2182 CDS 100% 13.200 10.560 N Ptk7 n/a
4 TRCN0000023610 CCAAGCCGCTATCGTCTTTAT pLKO.1 93 CDS 100% 13.200 9.240 N Ptk7 n/a
5 TRCN0000006434 CCTCATGTTCTACTGCAAGAA pLKO.1 2172 CDS 100% 4.950 3.465 N PTK7 n/a
6 TRCN0000023613 CCTGGGAGATCTCAAACAGTT pLKO.1 2646 CDS 100% 4.950 3.465 N Ptk7 n/a
7 TRCN0000023611 CTACTGCAAGAAGCGGTGTAA pLKO.1 2181 CDS 100% 4.950 3.465 N Ptk7 n/a
8 TRCN0000023609 GCCATGTTCCATTGCCAGTTT pLKO.1 733 CDS 100% 4.950 3.465 N Ptk7 n/a
9 TRCN0000023612 TGAGAGTGATACTGGTGTCTA pLKO.1 1155 CDS 100% 4.950 3.465 N Ptk7 n/a
10 TRCN0000195324 CCATGTTCCATTGCCAGTTCT pLKO.1 734 CDS 100% 4.950 3.465 N PTK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524922.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14820 pDONR223 0% 86.6% 90.2% None (many diffs) n/a
2 ccsbBroad304_14820 pLX_304 0% 86.6% 90.2% V5 (many diffs) n/a
3 TRCN0000487971 CCAGCCTACCTCCGCCCTACGATC pLX_317 7.7% 86.6% 90.2% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000487743 TTATCTCACTGTGTCGAGGCGGCT pLX_317 7.7% 86.6% 90.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488980 CTCGTATACCCCACCTCATTGTGC pLX_317 7.6% 86.6% 90.2% V5 (many diffs) n/a
6 TRCN0000488811 CATGTACGTATCCATCCGGAACCC pLX_317 7.6% 86.6% 90.2% V5 (many diffs) n/a
Download CSV