Transcript: Mouse XM_006525546.3

PREDICTED: Mus musculus calcium/calmodulin-dependent protein kinase IV (Camk4), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Camk4 (12326)
Length:
12166
CDS:
191..1600

Additional Resources:

NCBI RefSeq record:
XM_006525546.3
NBCI Gene record:
Camk4 (12326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147830 GTCCCGGATTACTGGATCGA pXPR_003 CGG 89 6% 2 0.7799 Camk4 CAMK4 77225
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361083 GTAGGCTGAAGATGGTTATAA pLKO_005 2053 3UTR 100% 15.000 21.000 N Camk4 n/a
2 TRCN0000361081 TACTGGATCGACGGCTCTAAC pLKO_005 272 CDS 100% 10.800 15.120 N Camk4 n/a
3 TRCN0000024313 GCGAGGTGATCAGTTCATGTT pLKO.1 910 CDS 100% 4.950 6.930 N Camk4 n/a
4 TRCN0000361084 ATACCAGTTGGTAACCCTAAT pLKO_005 1723 3UTR 100% 10.800 8.640 N Camk4 n/a
5 TRCN0000217998 CATGTGGTCTGTAGGAATAAT pLKO_005 847 CDS 100% 15.000 10.500 N CAMK4 n/a
6 TRCN0000361082 CGATTCAGCCAGAGTACTAAG pLKO_005 1581 CDS 100% 10.800 7.560 N Camk4 n/a
7 TRCN0000024309 CCGTTGCTTACCTGCATGAAA pLKO.1 630 CDS 100% 5.625 3.938 N Camk4 n/a
8 TRCN0000024311 TGGAGAAAGATGCAGGTGTAA pLKO.1 1386 CDS 100% 4.950 3.465 N Camk4 n/a
9 TRCN0000024310 CCTACATCCTACTTTGTGGAT pLKO.1 870 CDS 100% 2.640 1.848 N Camk4 n/a
10 TRCN0000024312 GCTGACTACATTTCAAGCCCT pLKO.1 1042 CDS 100% 0.660 0.462 N Camk4 n/a
11 TRCN0000075853 GCCTGGTCTATAGAGTGAGTT pLKO.1 7536 3UTR 100% 4.950 2.475 Y Oasl2 n/a
12 TRCN0000194517 GCCTGGTCTATAGAGTGAGTT pLKO.1 7536 3UTR 100% 4.950 2.475 Y Fbxo22 n/a
13 TRCN0000317452 GCCTGGTCTATAGAGTGAGTT pLKO_005 7536 3UTR 100% 4.950 2.475 Y Oasl2 n/a
14 TRCN0000181017 GCACATGCCTTTAATCCCAAT pLKO.1 9842 3UTR 100% 4.050 2.025 Y Map6d1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000480036 CACTTAGCGCAATCTTGCATAACG pLX_317 24.6% 82.9% 80.6% V5 (many diffs) n/a
2 ccsbBroadEn_05929 pDONR223 100% 82.8% 80.4% None (many diffs) n/a
3 ccsbBroad304_05929 pLX_304 0% 82.8% 80.4% V5 (many diffs) n/a
4 ccsbBroadEn_14561 pDONR223 0% 82.9% 80.6% None (many diffs) n/a
5 ccsbBroad304_14561 pLX_304 0% 82.9% 80.6% V5 (many diffs) n/a
6 TRCN0000480966 CAAAGATTTTAGCGCCCGCTTTCG pLX_317 29.4% 82.8% 80% V5 (not translated due to frame shift) (many diffs) n/a
7 TRCN0000488719 GAACGTGCGGTGTATCGCACCCCG pLX_317 19.9% 82.8% 80.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV