Transcript: Mouse XM_006526769.2

PREDICTED: Mus musculus phosphatase and tensin homolog (Pten), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pten (19211)
Length:
7849
CDS:
1308..2120

Additional Resources:

NCBI RefSeq record:
XM_006526769.2
NBCI Gene record:
Pten (19211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028992 GCTAGAACTTATCAAACCCTT pLKO.1 1199 5UTR 100% 2.640 3.696 N Pten n/a
2 TRCN0000322486 GCTAGAACTTATCAAACCCTT pLKO_005 1199 5UTR 100% 2.640 3.696 N Pten n/a
3 TRCN0000230372 TGCTGTGGCACAGGTTATAAA pLKO_005 4871 3UTR 100% 15.000 10.500 N PTEN n/a
4 TRCN0000322487 ACATTATGACACCGCCAAATT pLKO_005 1130 5UTR 100% 13.200 9.240 N Pten n/a
5 TRCN0000355946 ACATTATGACACCGCCAAATT pLKO_005 1130 5UTR 100% 13.200 9.240 N PTEN n/a
6 TRCN0000028990 GCCAGCTAAAGGTGAAGATAT pLKO.1 1561 CDS 100% 13.200 9.240 N Pten n/a
7 TRCN0000355840 GGCACAAGAGGCCCTAGATTT pLKO_005 1349 CDS 100% 13.200 9.240 N PTEN n/a
8 TRCN0000322424 TTGTGGCAACAGATAAGTTTG pLKO_005 2552 3UTR 100% 10.800 7.560 N Pten n/a
9 TRCN0000002746 CCACAGCTAGAACTTATCAAA pLKO.1 1194 5UTR 100% 5.625 3.938 N PTEN n/a
10 TRCN0000028993 CAACCGATACTTCTCTCCAAA pLKO.1 1907 CDS 100% 4.950 3.465 N Pten n/a
11 TRCN0000028989 GCAGATAATGACAAGGAGTAT pLKO.1 1833 CDS 100% 4.950 2.970 N Pten n/a
12 TRCN0000002747 CTAGAACTTATCAAACCCTTT pLKO.1 1200 5UTR 100% 4.050 2.835 N PTEN n/a
13 TRCN0000002748 CGTGCAGATAATGACAAGGAA pLKO.1 1830 CDS 100% 3.000 2.100 N PTEN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10499 pDONR223 100% 69.2% 71.2% None (many diffs) n/a
2 ccsbBroad304_10499 pLX_304 0% 69.2% 71.2% V5 (many diffs) n/a
3 TRCN0000479391 GCCAATCGATACGCGGTAGTTGCT pLX_317 32.1% 69.2% 71.2% V5 (many diffs) n/a
4 TRCN0000487886 CATTTCCCTCTCTTACTCCAATTC pLX_317 25.6% 63.8% 66.7% V5 (many diffs) n/a
5 TRCN0000489383 AGAAAGGTTCTACATGCGCCGCGG pLX_317 32.6% 63.8% 66.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV