Transcript: Mouse XM_006529716.3

PREDICTED: Mus musculus DENN/MADD domain containing 1B (Dennd1b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dennd1b (329260)
Length:
8010
CDS:
650..3010

Additional Resources:

NCBI RefSeq record:
XM_006529716.3
NBCI Gene record:
Dennd1b (329260)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006529716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130880 GCCATACCTGATTGGAATACA pLKO.1 1432 CDS 100% 5.625 7.875 N DENND1B n/a
2 TRCN0000216933 CTATAACCACCCAGTACCAAA pLKO.1 1048 CDS 100% 4.950 3.465 N Dennd1b n/a
3 TRCN0000192750 GCTATTTATTGCCAGTGAGCA pLKO.1 1105 CDS 100% 2.640 1.848 N Dennd1b n/a
4 TRCN0000127666 CAATGCCATACCTGATTGGAA pLKO.1 1428 CDS 100% 3.000 1.800 N DENND1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006529716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09752 pDONR223 100% 48.1% 48.9% None (many diffs) n/a
2 ccsbBroad304_09752 pLX_304 0% 48.1% 48.9% V5 (many diffs) n/a
3 TRCN0000472421 TCCAGGGGAAATTTCGAATCAGTT pLX_317 35% 48.1% 48.9% V5 (many diffs) n/a
4 ccsbBroadEn_13336 pDONR223 100% 44% 44.2% None (many diffs) n/a
5 ccsbBroad304_13336 pLX_304 0% 44% 44.2% V5 (many diffs) n/a
6 TRCN0000480837 CTCGATCCCTCTGATTCGAACTAC pLX_317 39.5% 44% 44.2% V5 (many diffs) n/a
Download CSV