Transcript: Mouse XM_006530760.3

PREDICTED: Mus musculus nuclear factor I/X (Nfix), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nfix (18032)
Length:
5749
CDS:
140..1768

Additional Resources:

NCBI RefSeq record:
XM_006530760.3
NBCI Gene record:
Nfix (18032)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006530760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075348 CCCAGCTACTACAACATAAAT pLKO.1 1316 CDS 100% 15.000 21.000 N Nfix n/a
2 TRCN0000225946 CCCAACGGGCACTTAAGTTTC pLKO_005 1181 CDS 100% 10.800 15.120 N Nfix n/a
3 TRCN0000234768 CCCAACGGGCACTTAAGTTTC pLKO_005 1181 CDS 100% 10.800 15.120 N NFIX n/a
4 TRCN0000225945 GGAATCCGGACAATCAGATAG pLKO_005 1123 CDS 100% 10.800 15.120 N Nfix n/a
5 TRCN0000234767 GGAATCCGGACAATCAGATAG pLKO_005 1123 CDS 100% 10.800 15.120 N NFIX n/a
6 TRCN0000225947 TCGTAACAATAGTAGACATTC pLKO_005 2251 3UTR 100% 10.800 15.120 N Nfix n/a
7 TRCN0000075349 CCGGACAATCAGATAGTTCAA pLKO.1 1128 CDS 100% 4.950 6.930 N Nfix n/a
8 TRCN0000234765 ACATTGGAGTCACAATCAAAG pLKO_005 1065 CDS 100% 10.800 8.640 N NFIX n/a
9 TRCN0000075351 GCCCGTATTTCACACACCCAA pLKO.1 1584 CDS 100% 2.640 2.112 N Nfix n/a
10 TRCN0000234769 TAGGCTAAGAAACGCAGTATA pLKO_005 5369 3UTR 100% 13.200 9.240 N NFIX n/a
11 TRCN0000218767 ACCTTTATCTGGCTTACTTTG pLKO_005 1092 CDS 100% 10.800 7.560 N Nfix n/a
12 TRCN0000075350 CAATCAAAGAACTGGACCTTT pLKO.1 1077 CDS 100% 4.950 3.465 N Nfix n/a
13 TRCN0000014777 CACATCACATTGGAGTCACAA pLKO.1 1059 CDS 100% 4.950 3.465 N NFIX n/a
14 TRCN0000075352 GCTAACCATCACGGGCAAGAA pLKO.1 841 CDS 100% 4.950 3.465 N Nfix n/a
15 TRCN0000014773 GCAGTCTCAGTCCTGGTTCCT pLKO.1 1779 3UTR 100% 0.880 0.616 N NFIX n/a
16 TRCN0000257244 TGGACCTGGTCATGGTGATTT pLKO_005 951 CDS 100% 13.200 7.920 N Nfix n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006530760.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14713 pDONR223 62.1% 64% 66.8% None (many diffs) n/a
2 ccsbBroad304_14713 pLX_304 0% 64% 66.8% V5 (many diffs) n/a
3 TRCN0000478179 ATTAACTCACTCCAACAAGGAAAG pLX_317 37.2% 45.9% 47% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV