Transcript: Mouse XM_006534034.1

PREDICTED: Mus musculus solute carrier family 25, member 39 (Slc25a39), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a39 (68066)
Length:
1514
CDS:
157..1236

Additional Resources:

NCBI RefSeq record:
XM_006534034.1
NBCI Gene record:
Slc25a39 (68066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114280 GTACTGGTTCAACTACGAGTT pLKO.1 852 CDS 100% 4.050 5.670 N Slc25a39 n/a
2 TRCN0000317682 GTACTGGTTCAACTACGAGTT pLKO_005 852 CDS 100% 4.050 5.670 N Slc25a39 n/a
3 TRCN0000114279 CGTGCCAGCTACTGCTATCTA pLKO.1 558 CDS 100% 5.625 3.938 N Slc25a39 n/a
4 TRCN0000317681 CGTGCCAGCTACTGCTATCTA pLKO_005 558 CDS 100% 5.625 3.938 N Slc25a39 n/a
5 TRCN0000114276 AGACCTGGATTCCTGCTGTTT pLKO.1 1327 3UTR 100% 4.950 3.465 N Slc25a39 n/a
6 TRCN0000317683 AGACCTGGATTCCTGCTGTTT pLKO_005 1327 3UTR 100% 4.950 3.465 N Slc25a39 n/a
7 TRCN0000114277 GCCAGCTACTGCTATCTACTT pLKO.1 561 CDS 100% 4.950 3.465 N Slc25a39 n/a
8 TRCN0000114278 CCCAGGGAAGTGCCTCCTATA pLKO.1 366 CDS 100% 3.600 2.520 N Slc25a39 n/a
9 TRCN0000317757 CCCAGGGAAGTGCCTCCTATA pLKO_005 366 CDS 100% 3.600 2.520 N Slc25a39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08332 pDONR223 100% 84.3% 86.9% None (many diffs) n/a
2 ccsbBroad304_08332 pLX_304 0% 84.3% 86.9% V5 (many diffs) n/a
3 TRCN0000467005 TCACATAAATCGCGGGAGCTGACA pLX_317 37.6% 84.3% 86.9% V5 (many diffs) n/a
4 ccsbBroadEn_15070 pDONR223 71.4% 83.8% 86.3% None (many diffs) n/a
5 ccsbBroad304_15070 pLX_304 0% 83.8% 86.3% V5 (many diffs) n/a
6 TRCN0000468814 TATTCTCATTTCATTCAAAGCAAT pLX_317 37.3% 83.8% 86.3% V5 (many diffs) n/a
Download CSV