Transcript: Mouse XM_006537606.3

PREDICTED: Mus musculus Eph receptor A7 (Epha7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Epha7 (13841)
Length:
6822
CDS:
338..3319

Additional Resources:

NCBI RefSeq record:
XM_006537606.3
NBCI Gene record:
Epha7 (13841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006537606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321889 AGAATGGTTGCAAGCTATTAA pLKO_005 3109 CDS 100% 15.000 21.000 N Epha7 n/a
2 TRCN0000321958 CTGCGAAGGAAGTACTATTAC pLKO_005 423 CDS 100% 13.200 18.480 N Epha7 n/a
3 TRCN0000023679 GCGGGCACAAATGTTGCATTT pLKO.1 3274 CDS 100% 10.800 15.120 N Epha7 n/a
4 TRCN0000023680 CGGAAGTAACATTGGATACAT pLKO.1 1483 CDS 100% 5.625 7.875 N Epha7 n/a
5 TRCN0000023683 CCGGCAGGAATATACGAGAAA pLKO.1 738 CDS 100% 4.950 6.930 N Epha7 n/a
6 TRCN0000321888 CCTAAGTGCCACCAGAATATA pLKO_005 3470 3UTR 100% 15.000 12.000 N Epha7 n/a
7 TRCN0000023681 CCACCCAAATGTCGTCCATTT pLKO.1 2392 CDS 100% 1.080 0.756 N Epha7 n/a
8 TRCN0000023682 CGATAGAAGAAGGTTATCGTT pLKO.1 2865 CDS 100% 0.300 0.210 N Epha7 n/a
9 TRCN0000321887 CGATAGAAGAAGGTTATCGTT pLKO_005 2865 CDS 100% 0.300 0.210 N Epha7 n/a
10 TRCN0000321890 CTTGCAAGGAAACGTTTAATT pLKO_005 690 CDS 100% 15.000 9.000 N Epha7 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4567 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000006420 CCAGTGAACAGAATCCTGTTA pLKO.1 1968 CDS 100% 0.495 0.347 N EPHA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006537606.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06169 pDONR223 99.8% 90.7% 97.5% None (many diffs) n/a
2 ccsbBroad304_06169 pLX_304 0% 90.7% 97.5% V5 (many diffs) n/a
3 TRCN0000488943 CTGGTATCGTCGGTGTGCGGGGAA pLX_317 11.9% 90.3% 89.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489864 TTAGACTCGCTATCAGCCAGGGCC pLX_317 13.7% 90.3% 89.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489138 ACCCCACAATCCATATCACTCTGT pLX_317 26.9% 36.7% 1.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_10803 pDONR223 100% 26% 27.1% None (many diffs) n/a
7 ccsbBroad304_10803 pLX_304 0% 26% 27.1% V5 (many diffs) n/a
8 TRCN0000468569 AAAGGCACATGGAGATCTATATTT pLX_317 51.8% 26% 27.1% V5 (many diffs) n/a
Download CSV