Transcript: Mouse XM_006538010.2

PREDICTED: Mus musculus expressed sequence AI464131 (AI464131), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
AI464131 (329828)
Length:
4611
CDS:
586..2736

Additional Resources:

NCBI RefSeq record:
XM_006538010.2
NBCI Gene record:
AI464131 (329828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252435 ATCCGCCAGCACCGCTTTAAT pLKO_005 1600 CDS 100% 15.000 21.000 N AI464131 n/a
2 TRCN0000252433 TGGGTCTTTGATGCTAGATAA pLKO_005 3696 3UTR 100% 13.200 18.480 N AI464131 n/a
3 TRCN0000252434 TCCGTTCATCTTGCCCGATAT pLKO_005 2220 CDS 100% 10.800 15.120 N AI464131 n/a
4 TRCN0000258238 CATCCGTTTGTCAACTATAAC pLKO_005 1756 CDS 100% 13.200 10.560 N AI464131 n/a
5 TRCN0000252432 TTGTCACGAGCGACGTCTATT pLKO_005 1208 CDS 100% 13.200 9.240 N AI464131 n/a
6 TRCN0000075853 GCCTGGTCTATAGAGTGAGTT pLKO.1 3257 3UTR 100% 4.950 2.475 Y Oasl2 n/a
7 TRCN0000194517 GCCTGGTCTATAGAGTGAGTT pLKO.1 3257 3UTR 100% 4.950 2.475 Y Fbxo22 n/a
8 TRCN0000317452 GCCTGGTCTATAGAGTGAGTT pLKO_005 3257 3UTR 100% 4.950 2.475 Y Oasl2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3967 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3198 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08729 pDONR223 100% 83.8% 91.6% None (many diffs) n/a
2 ccsbBroad304_08729 pLX_304 0% 83.8% 91.6% V5 (many diffs) n/a
3 TRCN0000481462 CAGCTTTTCTACTGCCAAGTCACG pLX_317 24.6% 83.8% 91.6% V5 (many diffs) n/a
Download CSV