Transcript: Human XM_006711193.3

PREDICTED: Homo sapiens DENN domain containing 1B (DENND1B), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DENND1B (163486)
Length:
8420
CDS:
411..2708

Additional Resources:

NCBI RefSeq record:
XM_006711193.3
NBCI Gene record:
DENND1B (163486)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006711193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130880 GCCATACCTGATTGGAATACA pLKO.1 1163 CDS 100% 5.625 7.875 N DENND1B n/a
2 TRCN0000107098 CGAATAAATCTAATGCTCCTA pLKO.1 2194 CDS 100% 2.640 3.696 N DENND1B n/a
3 TRCN0000107099 CCTCTAGTGGTTTGACAGATT pLKO.1 2335 CDS 100% 4.950 3.465 N DENND1B n/a
4 TRCN0000107095 GCCTTAATCTTAAAGCTGTTT pLKO.1 3129 3UTR 100% 4.950 3.465 N DENND1B n/a
5 TRCN0000107097 GCTCCATGAAGTAGTGTCATT pLKO.1 2615 CDS 100% 4.950 3.465 N DENND1B n/a
6 TRCN0000131148 GAGATCACTTCAGGTGGCTTT pLKO.1 1593 CDS 100% 4.050 2.835 N DENND1B n/a
7 TRCN0000127666 CAATGCCATACCTGATTGGAA pLKO.1 1159 CDS 100% 3.000 2.100 N DENND1B n/a
8 TRCN0000107096 GCTGGGACTAAAGGAAGTGAA pLKO.1 1748 CDS 100% 4.950 2.970 N DENND1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006711193.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09752 pDONR223 100% 52.2% 49.2% None (many diffs) n/a
2 ccsbBroad304_09752 pLX_304 0% 52.2% 49.2% V5 (many diffs) n/a
3 TRCN0000472421 TCCAGGGGAAATTTCGAATCAGTT pLX_317 35% 52.2% 49.2% V5 (many diffs) n/a
4 ccsbBroadEn_13336 pDONR223 100% 51.2% 49.8% None (many diffs) n/a
5 ccsbBroad304_13336 pLX_304 0% 51.2% 49.8% V5 (many diffs) n/a
6 TRCN0000480837 CTCGATCCCTCTGATTCGAACTAC pLX_317 39.5% 51.2% 49.8% V5 (many diffs) n/a
Download CSV