Transcript: Human XM_006716439.3

PREDICTED: Homo sapiens sulfatase 1 (SULF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SULF1 (23213)
Length:
5485
CDS:
527..3895

Additional Resources:

NCBI RefSeq record:
XM_006716439.3
NBCI Gene record:
SULF1 (23213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051101 CGTCGAATTTGAAGGTGAAAT pLKO.1 2167 CDS 100% 13.200 18.480 N SULF1 n/a
2 TRCN0000051098 CCCAAATATGAACGGGTCAAA pLKO.1 1832 CDS 100% 4.950 6.930 N SULF1 n/a
3 TRCN0000051102 CGTACAGTTAATGAGACGCAT pLKO.1 2864 CDS 100% 2.640 3.696 N SULF1 n/a
4 TRCN0000373588 GCGAGAATGGCTTGGATTAAT pLKO_005 994 CDS 100% 15.000 10.500 N SULF1 n/a
5 TRCN0000373589 TCTGGTGGACTGGACTAATTA pLKO_005 3208 CDS 100% 15.000 10.500 N SULF1 n/a
6 TRCN0000373658 GCCGACCATGGTTACCATATT pLKO_005 1469 CDS 100% 13.200 9.240 N SULF1 n/a
7 TRCN0000051099 CCAACACATAACTCCTAGTTA pLKO.1 1252 CDS 100% 5.625 3.938 N SULF1 n/a
8 TRCN0000051100 CCAAGACCTAAGAATCTTGAT pLKO.1 3053 CDS 100% 0.495 0.347 N SULF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716439.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489880 TATCTAGATAGGGCTCACAGCACC pLX_317 17% 75.9% 76.2% V5 (not translated due to prior stop codon) 2550_2551ins34;2583T>G;2585_3366del n/a
2 TRCN0000489537 CCCGTCCTGAATGCGCACCTCTTC pLX_317 15% 75.8% 76.2% V5 2550_2551ins34;2580_3366delinsG n/a
3 ccsbBroadEn_11696 pDONR223 100% 56.2% 53.4% None (many diffs) n/a
4 ccsbBroad304_11696 pLX_304 0% 56.2% 53.4% V5 (many diffs) n/a
5 TRCN0000470613 TTACCGGTAGAGGTGTGCAACAGT pLX_317 22.3% 56.2% 53.4% V5 (many diffs) n/a
Download CSV