Transcript: Human XM_006716520.4

PREDICTED: Homo sapiens eukaryotic translation elongation factor 1 delta (EEF1D), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EEF1D (1936)
Length:
1948
CDS:
13..1884

Additional Resources:

NCBI RefSeq record:
XM_006716520.4
NBCI Gene record:
EEF1D (1936)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006716520.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047209 CGACGCAGAAAGGAGATTCTA pLKO.1 1167 CDS 100% 5.625 7.875 N EEF1D n/a
2 TRCN0000412902 TTCAAATATGACGACGCAGAA pLKO_005 1156 CDS 100% 4.050 5.670 N EEF1D n/a
3 TRCN0000428434 TACGGCAGTACGCGGAGAAGA pLKO_005 1574 CDS 100% 1.650 2.310 N EEF1D n/a
4 TRCN0000427560 CGTATCTCCCATGCGCCAAGT pLKO_005 1431 CDS 100% 1.350 1.890 N EEF1D n/a
5 TRCN0000420930 TCCGGATTGCCAGTCTGGAAG pLKO_005 1283 CDS 100% 1.350 1.890 N EEF1D n/a
6 TRCN0000047212 CGGAAGCTACAGATTCAGTGT pLKO.1 1759 CDS 100% 2.640 2.112 N EEF1D n/a
7 TRCN0000421623 TCTGGTTCGACAAGTTCAAAT pLKO_005 1142 CDS 100% 13.200 9.240 N EEF1D n/a
8 TRCN0000435061 AGATTCTACGAGCAGATGAAC pLKO_005 1180 CDS 100% 4.950 3.465 N EEF1D n/a
9 TRCN0000426247 CCTGTTTGGCAGTGACAATGA pLKO_005 1512 CDS 100% 4.950 3.465 N EEF1D n/a
10 TRCN0000047210 AGGATGATGACATTGACCTGT pLKO.1 1496 CDS 100% 2.640 1.584 N EEF1D n/a
11 TRCN0000047211 GAAGGCCAAGAAGCCTGCACT pLKO.1 1593 CDS 100% 0.880 0.528 N EEF1D n/a
12 TRCN0000155285 GCAGAAAGGAGATTCTACGAA pLKO.1 1171 CDS 100% 3.000 2.100 N EEF1DP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006716520.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06140 pDONR223 100% 96.1% 96.1% None (many diffs) n/a
2 ccsbBroad304_06140 pLX_304 0% 96.1% 96.1% V5 (many diffs) n/a
3 TRCN0000467412 CATAATCATGTCTCCCTTCAGCCG pLX_317 11.8% 96.1% 96.1% V5 (many diffs) n/a
4 ccsbBroadEn_15404 pDONR223 0% 39.6% 39.7% None 1_1098del;1215_1216ins72;1662C>T n/a
5 ccsbBroad304_15404 pLX_304 0% 39.6% 39.7% V5 1_1098del;1215_1216ins72;1662C>T n/a
6 TRCN0000470997 ATCGTCCTTTTTTCTTTTCATCTA pLX_317 52.6% 39.6% 39.7% V5 1_1098del;1215_1216ins72;1662C>T n/a
7 ccsbBroadEn_13371 pDONR223 100% 15.6% 10.4% None (many diffs) n/a
8 ccsbBroad304_13371 pLX_304 0% 15.6% 10.4% V5 (many diffs) n/a
9 TRCN0000473083 CTATGCTTCTACGCGATTGGTTGC pLX_317 88.5% 15.6% 10.4% V5 (many diffs) n/a
Download CSV