Transcript: Human XM_006720375.2

PREDICTED: Homo sapiens calcium and integrin binding 1 (CIB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CIB1 (10519)
Length:
891
CDS:
55..849

Additional Resources:

NCBI RefSeq record:
XM_006720375.2
NBCI Gene record:
CIB1 (10519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147329 GTTCTCACCAAAGATGCGGA pXPR_003 AGG 337 42% 4 0.5505 CIB1 CIB1 76950
2 BRDN0001147177 GGAGCGTGGAGTCGTCACTT pXPR_003 CGG 144 18% 3 0.4279 CIB1 CIB1 76949
3 BRDN0001147051 CTTCAAGGAGCGAATCTGCA pXPR_003 GGG 220 28% 4 0.3972 CIB1 CIB1 76951
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006720375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053588 CCAGACATCAAGTCCCATTAT pLKO.1 364 CDS 100% 13.200 9.240 N CIB1 n/a
2 TRCN0000333329 CCAGACATCAAGTCCCATTAT pLKO_005 364 CDS 100% 13.200 9.240 N CIB1 n/a
3 TRCN0000382068 ATGATGACGGAACCTTGAACA pLKO_005 407 CDS 100% 4.950 3.465 N CIB1 n/a
4 TRCN0000053589 GCCTTCCGCATCTTTGACTTT pLKO.1 385 CDS 100% 4.950 3.465 N CIB1 n/a
5 TRCN0000333330 GCCTTCCGCATCTTTGACTTT pLKO_005 385 CDS 100% 4.950 3.465 N CIB1 n/a
6 TRCN0000053591 CAGCCTTAGCTTTGAGGACTT pLKO.1 306 CDS 100% 4.050 2.835 N CIB1 n/a
7 TRCN0000333398 CAGCCTTAGCTTTGAGGACTT pLKO_005 306 CDS 100% 4.050 2.835 N CIB1 n/a
8 TRCN0000053590 GTCTGAGATGAAGCAGCTCAT pLKO.1 492 CDS 100% 4.050 2.835 N CIB1 n/a
9 TRCN0000333400 GTCTGAGATGAAGCAGCTCAT pLKO_005 492 CDS 100% 4.050 2.835 N CIB1 n/a
10 TRCN0000380913 TCTGAGTTCCAGCACGTCATC pLKO_005 565 CDS 100% 4.050 2.835 N CIB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006720375.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14970 pDONR223 100% 71.8% 70.4% None (many diffs) n/a
2 ccsbBroad304_14970 pLX_304 0% 71.8% 70.4% V5 (many diffs) n/a
3 TRCN0000474789 TAATACCAGACATGCCCCAAAATT pLX_317 64.5% 54.2% 29.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_14967 pDONR223 100% 71.8% 70.4% None (many diffs) n/a
5 ccsbBroad304_14967 pLX_304 0% 71.8% 70.4% V5 (many diffs) n/a
6 TRCN0000467943 GTCCACGAAGTGATTACTTGTGCA pLX_317 60% 71.8% 70.4% V5 (many diffs) n/a
Download CSV