Transcript: Human XM_006722237.2

PREDICTED: Homo sapiens TBC1 domain family member 3K (TBC1D3K), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D3K (101060351)
Length:
4160
CDS:
2196..3845

Additional Resources:

NCBI RefSeq record:
XM_006722237.2
NBCI Gene record:
TBC1D3K (101060351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267633 AGGGCTCATGGCTGGATAATT pLKO_005 3859 3UTR 100% 15.000 7.500 Y n/a
2 TRCN0000255681 GGACATTAAGGAAGCATATAT pLKO_005 2647 CDS 100% 15.000 7.500 Y TBC1D3 n/a
3 TRCN0000262160 GGGCTCATGGCTGGATAATTT pLKO_005 3860 3UTR 100% 15.000 7.500 Y TBC1D3F n/a
4 TRCN0000256844 AGGCTGCCTCATCCGGATATT pLKO_005 2993 CDS 100% 13.200 6.600 Y n/a
5 TRCN0000262158 ATAACAAGAATCGCCTTTAAG pLKO_005 3093 CDS 100% 13.200 6.600 Y TBC1D3F n/a
6 TRCN0000262161 GAGCGAGAGGACATCATTATG pLKO_005 2235 CDS 100% 13.200 6.600 Y TBC1D3F n/a
7 TRCN0000265682 GATAACAAGAATCGCCTTTAA pLKO_005 3092 CDS 100% 13.200 6.600 Y TBC1D3 n/a
8 TRCN0000282350 GGCTCATGGCTGGATAATTTC pLKO_005 3861 3UTR 100% 13.200 6.600 Y TBC1D3H n/a
9 TRCN0000437046 GGGACGTAAGCGGGACATTAA pLKO_005 2635 CDS 100% 13.200 6.600 Y TBC1D3F n/a
10 TRCN0000262159 TTGGTTCCGCCATTATGATTT pLKO_005 3596 CDS 100% 13.200 6.600 Y TBC1D3F n/a
11 TRCN0000256846 ACAGGCGTTGATGCCGATAAC pLKO_005 3077 CDS 100% 10.800 5.400 Y n/a
12 TRCN0000421126 CACTGTGCTCAAGCATCTTAG pLKO_005 3206 CDS 100% 10.800 5.400 Y TBC1D3F n/a
13 TRCN0000118545 CAGGGATTTCACAGCCCAAAT pLKO.1 2859 CDS 100% 10.800 5.400 Y TBC1D3C n/a
14 TRCN0000118538 CCTCCTGAACATTGAGGAAAT pLKO.1 2534 CDS 100% 10.800 5.400 Y TBC1D3B n/a
15 TRCN0000118542 CGATAACAAGAATCGCCTTTA pLKO.1 3091 CDS 100% 10.800 5.400 Y TBC1D3C n/a
16 TRCN0000052405 CGGGACATTAAGGAAGCATAT pLKO.1 2645 CDS 100% 10.800 5.400 Y NPEPPSP1 n/a
17 TRCN0000414626 GATAATTTCCCTAGGCTTAAC pLKO_005 3873 3UTR 100% 10.800 5.400 Y TBC1D3F n/a
18 TRCN0000432336 GCCTCATCCGGATATTGATTG pLKO_005 2998 CDS 100% 10.800 5.400 Y TBC1D3F n/a
19 TRCN0000255682 GGATAATTTCCCTAGGCTTAA pLKO_005 3872 3UTR 100% 10.800 5.400 Y TBC1D3 n/a
20 TRCN0000262629 GGTCAGTCCTCCTGAACATTG pLKO_005 2527 CDS 100% 10.800 5.400 Y TBC1D3H n/a
21 TRCN0000255679 TAGGCTGCCTCATCCGGATAT pLKO_005 2992 CDS 100% 10.800 5.400 Y TBC1D3 n/a
22 TRCN0000262630 TGGTTCCGCCATTATGATTTC pLKO_005 3597 CDS 100% 10.800 5.400 Y TBC1D3H n/a
23 TRCN0000452941 TTGATGCCGATAACAAGAATC pLKO_005 3084 CDS 100% 10.800 5.400 Y TBC1D3B n/a
24 TRCN0000255680 TTGCAACCGGTTCGTTGATAC pLKO_005 3167 CDS 100% 10.800 5.400 Y TBC1D3 n/a
25 TRCN0000262628 AGGCGTTGATGCCGATAACAA pLKO_005 3079 CDS 100% 5.625 2.813 Y TBC1D3H n/a
26 TRCN0000118239 CGAGAGGACATCATTATGAAA pLKO.1 2238 CDS 100% 5.625 2.813 Y TBC1D3F n/a
27 TRCN0000118540 GCCTTGTTCCTCCTCTATCTT pLKO.1 2778 CDS 100% 5.625 2.813 Y TBC1D3B n/a
28 TRCN0000118541 CAAGCATCTTAGGGCCTCTAT pLKO.1 3215 CDS 100% 4.950 2.475 Y TBC1D3B n/a
29 TRCN0000118241 CCACTTGGAAAGTTCTCAGTT pLKO.1 3809 CDS 100% 4.950 2.475 Y TBC1D3F n/a
30 TRCN0000118546 GCTCATAGATCGAGCGTACAA pLKO.1 2474 CDS 100% 4.950 2.475 Y TBC1D3C n/a
31 TRCN0000118240 CCGATAACAAGAATCGCCTTT pLKO.1 3090 CDS 100% 4.050 2.025 Y TBC1D3F n/a
32 TRCN0000118237 CCAGATCACAAAGCCAACCAT pLKO.1 4001 3UTR 100% 3.000 1.500 Y TBC1D3F n/a
33 TRCN0000052404 GCGTTATTCCTAAAGTGGCTT pLKO.1 1659 5UTR 100% 2.640 1.320 Y NPEPPSP1 n/a
34 TRCN0000118539 CCGGATATTGATTGACGGGAT pLKO.1 3005 CDS 100% 2.160 1.080 Y TBC1D3B n/a
35 TRCN0000118238 GCCGATAACAAGAATCGCCTT pLKO.1 3089 CDS 100% 2.160 1.080 Y TBC1D3F n/a
36 TRCN0000118544 CCTGGCATATGAGGAGTATAA pLKO.1 2717 CDS 100% 0.000 0.000 Y TBC1D3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722237.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10145 pDONR223 100% 99.6% 99.2% None (many diffs) n/a
2 ccsbBroad304_10145 pLX_304 0% 99.6% 99.2% V5 (many diffs) n/a
3 ccsbBroadEn_13681 pDONR223 100% 62.4% 52.2% None (many diffs) n/a
4 ccsbBroad304_13681 pLX_304 0% 62.4% 52.2% V5 (many diffs) n/a
5 TRCN0000467436 TGGATCCTATGCCTCATTGTTTAG pLX_317 29% 62.4% 52.2% V5 (many diffs) n/a
6 ccsbBroadEn_13692 pDONR223 100% 60.3% 48.4% None (many diffs) n/a
7 ccsbBroad304_13692 pLX_304 0% 60.3% 48.4% V5 (many diffs) n/a
8 TRCN0000471618 GCCCATAACCCTACGTGGCCAATT pLX_317 40.7% 60.3% 48.4% V5 (many diffs) n/a
9 ccsbBroadEn_12794 pDONR223 100% 52.8% 44.8% None (many diffs) n/a
10 ccsbBroad304_12794 pLX_304 0% 52.8% 44.8% V5 (many diffs) n/a
Download CSV