Transcript: Human XM_006722278.4

PREDICTED: Homo sapiens nuclear prelamin A recognition factor (NARF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NARF (26502)
Length:
3845
CDS:
230..1465

Additional Resources:

NCBI RefSeq record:
XM_006722278.4
NBCI Gene record:
NARF (26502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006722278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064220 CCGCGTTCTGAACCTTAACAA pLKO.1 460 CDS 100% 5.625 7.875 N NARF n/a
2 TRCN0000299745 CCGCGTTCTGAACCTTAACAA pLKO_005 460 CDS 100% 5.625 7.875 N NARF n/a
3 TRCN0000064219 GCGTGTTAACATCAGGTGAAA pLKO.1 849 CDS 100% 4.950 6.930 N NARF n/a
4 TRCN0000299814 GCGTGTTAACATCAGGTGAAA pLKO_005 849 CDS 100% 4.950 6.930 N NARF n/a
5 TRCN0000064222 CTGGCACACATCTTCAGACAT pLKO.1 989 CDS 100% 4.950 3.465 N NARF n/a
6 TRCN0000299813 CTGGCACACATCTTCAGACAT pLKO_005 989 CDS 100% 4.950 3.465 N NARF n/a
7 TRCN0000064221 GAGTCCAACTTTCCCAGCAAA pLKO.1 423 CDS 100% 4.950 3.465 N NARF n/a
8 TRCN0000299810 GAGTCCAACTTTCCCAGCAAA pLKO_005 423 CDS 100% 4.950 3.465 N NARF n/a
9 TRCN0000064218 GCTAAATTCAACCTCAGTGTA pLKO.1 551 CDS 100% 4.950 3.465 N NARF n/a
10 TRCN0000299744 GCTAAATTCAACCTCAGTGTA pLKO_005 551 CDS 100% 4.950 3.465 N NARF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006722278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08019 pDONR223 100% 81.8% 81.6% None 383_384ins135;632_633ins138;1169G>A n/a
2 ccsbBroad304_08019 pLX_304 0% 81.8% 81.6% V5 383_384ins135;632_633ins138;1169G>A n/a
3 TRCN0000467775 AATGTCAATCCCCGATGTAATACG pLX_317 24.9% 81.8% 81.6% V5 383_384ins135;632_633ins138;1169G>A n/a
4 ccsbBroadEn_08018 pDONR223 100% 79.5% 79.3% None 10G>A;107_250del;383_384ins135 n/a
5 ccsbBroad304_08018 pLX_304 0% 79.5% 79.3% V5 10G>A;107_250del;383_384ins135 n/a
6 TRCN0000466745 GTAAGCTGTGGGATGTCCCGAATG pLX_317 26.1% 79.5% 79.3% V5 10G>A;107_250del;383_384ins135 n/a
Download CSV