Transcript: Human XM_006723884.1

PREDICTED: Homo sapiens TOX high mobility group box family member 2 (TOX2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOX2 (84969)
Length:
2495
CDS:
18..1565

Additional Resources:

NCBI RefSeq record:
XM_006723884.1
NBCI Gene record:
TOX2 (84969)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006723884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021289 AGCGAGAACAACGAAGACTAT pLKO.1 225 CDS 100% 4.950 6.930 N TOX2 n/a
2 TRCN0000420740 TTCCGTGTAAGTAGTTGACTA pLKO_005 2028 3UTR 100% 4.950 6.930 N TOX2 n/a
3 TRCN0000423270 CATAGATGTGCACATCGGTTT pLKO_005 1966 3UTR 100% 4.050 5.670 N TOX2 n/a
4 TRCN0000021291 ACTTTCGGTGACGTGTCCAAA pLKO.1 858 CDS 100% 4.950 3.465 N TOX2 n/a
5 TRCN0000415270 AGCAAAGAAGGAATATCTGAA pLKO_005 947 CDS 100% 4.950 3.465 N TOX2 n/a
6 TRCN0000433420 ATTTCAAGATCTCGGGAGAAA pLKO_005 688 CDS 100% 4.950 3.465 N TOX2 n/a
7 TRCN0000434191 GATTACGAAACCTAGAAACTG pLKO_005 2003 3UTR 100% 4.950 3.465 N TOX2 n/a
8 TRCN0000021292 CAAATCGCTCTACCTCACCTA pLKO.1 1544 CDS 100% 2.640 1.848 N TOX2 n/a
9 TRCN0000021293 CCCAGATCAAGGTGAGACCAA pLKO.1 1010 CDS 100% 2.640 1.848 N TOX2 n/a
10 TRCN0000021290 CCCTCCTCAGTCCACCTGTTA pLKO.1 1288 CDS 100% 1.650 1.155 N TOX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006723884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04457 pDONR223 100% 90% 90% None 1_153del n/a
2 ccsbBroad304_04457 pLX_304 0% 90% 90% V5 1_153del n/a
3 TRCN0000473000 ATTATAAGGAATGTCTACAAAAGG pLX_317 24.5% 90% 90% V5 1_153del n/a
Download CSV