Transcript: Human XM_006724498.4

PREDICTED: Homo sapiens phosphorylase kinase regulatory subunit alpha 2 (PHKA2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHKA2 (5256)
Length:
4773
CDS:
401..3586

Additional Resources:

NCBI RefSeq record:
XM_006724498.4
NBCI Gene record:
PHKA2 (5256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724498.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006193 CCCATGACTTTGCCGACTAAA pLKO.1 1997 CDS 100% 13.200 18.480 N PHKA2 n/a
2 TRCN0000006195 GCATATAAAGTCGCTGATTAT pLKO.1 377 5UTR 100% 13.200 18.480 N PHKA2 n/a
3 TRCN0000006194 CCGCCTAACAAGGTAGATGAA pLKO.1 980 CDS 100% 4.950 6.930 N PHKA2 n/a
4 TRCN0000195659 CCTGGAAACATGATCACACTC pLKO.1 3594 3UTR 100% 4.050 5.670 N PHKA2 n/a
5 TRCN0000194890 CCTTGGAACCTCTAAACTATA pLKO.1 1366 CDS 100% 13.200 10.560 N PHKA2 n/a
6 TRCN0000196686 GCTGGACTTCTTTCCATTATT pLKO.1 623 CDS 100% 15.000 10.500 N PHKA2 n/a
7 TRCN0000197163 GAACTGAGACGCCAGCTTAAA pLKO.1 3908 3UTR 100% 13.200 9.240 N PHKA2 n/a
8 TRCN0000006192 GCTGCCTTGATGTAACATAAT pLKO.1 4156 3UTR 100% 13.200 9.240 N PHKA2 n/a
9 TRCN0000196701 GATTCAGATTTGGTAGGATAT pLKO.1 1775 CDS 100% 10.800 7.560 N PHKA2 n/a
10 TRCN0000196252 GCTTCTTATTTGCAGGAATTG pLKO.1 3536 CDS 100% 10.800 7.560 N PHKA2 n/a
11 TRCN0000011000 GCGGACATTCATCCAATTCAA pLKO.1 1250 CDS 100% 5.625 3.938 N PHKA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724498.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14752 pDONR223 41.7% 84.1% 4.9% None (many diffs) n/a
2 ccsbBroad304_14752 pLX_304 0% 84.1% 4.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000474480 ATAAAGTGTCCTGGCGATGTGCCC pLX_317 10.6% 84.1% 4.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV