Transcript: Human XM_006725184.3

PREDICTED: Homo sapiens golgin A6 family like 19 (GOLGA6L19), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGA6L19 (101927601)
Length:
4475
CDS:
63..1715

Additional Resources:

NCBI RefSeq record:
XM_006725184.3
NBCI Gene record:
GOLGA6L19 (101927601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006725184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269219 GGATTCAAGCTCCGCAATAAT pLKO_005 356 CDS 100% 15.000 7.500 Y GOLGA6L9 n/a
2 TRCN0000283947 TTTACCCTGACACGTATAAAT pLKO_005 3558 3UTR 100% 15.000 7.500 Y GOLGA6L9 n/a
3 TRCN0000162932 GCAGTTGGAGCAGCAAGTAAA pLKO.1 1442 CDS 100% 13.200 6.600 Y GOLGA8B n/a
4 TRCN0000269218 CAGTTGGAGCAGCAAGTAAAG pLKO_005 1443 CDS 100% 10.800 5.400 Y GOLGA6L9 n/a
5 TRCN0000150250 GAGAAGAAGCATGAGATACAT pLKO.1 426 CDS 100% 5.625 2.813 Y GOLGA6L5P n/a
6 TRCN0000180631 GAGGTGGAGAAGCTGTTAGAA pLKO.1 1149 CDS 100% 5.625 2.813 Y GOLGA6L9 n/a
7 TRCN0000180938 GAAGAGGTGGAGAAGCTGTTA pLKO.1 1146 CDS 100% 4.950 2.475 Y GOLGA6L5P n/a
8 TRCN0000179455 GAGGAGAAGAAGCATGAGATA pLKO.1 423 CDS 100% 4.950 2.475 Y GOLGA6L5P n/a
9 TRCN0000149653 GAGGAGCTTGTTCAAACTCAA pLKO.1 464 CDS 100% 4.950 2.475 Y GOLGA6L5P n/a
10 TRCN0000153184 GTGGGAGTTCAAACACACAAA pLKO.1 2059 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
11 TRCN0000180460 GCAAGTAAAGGAGCTGGAGAA pLKO.1 1454 CDS 100% 4.050 2.025 Y GOLGA6L9 n/a
12 TRCN0000149152 GCATGAGATACATCTGGTACA pLKO.1 434 CDS 100% 4.050 2.025 Y GOLGA6L5P n/a
13 TRCN0000269223 AGAGGTGGAGAAGCTGTTAAA pLKO_005 1148 CDS 100% 13.200 6.600 Y GOLGA6L9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006725184.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15313 pDONR223 80.2% 78.9% 12% None (many diffs) n/a
2 ccsbBroad304_15313 pLX_304 0% 78.9% 12% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13690 pDONR223 100% 49.3% 48.9% None (many diffs) n/a
4 ccsbBroad304_13690 pLX_304 0% 49.3% 48.9% V5 (many diffs) n/a
5 ccsbBroadEn_15348 pDONR223 64.5% 31.7% 27% None (many diffs) n/a
6 ccsbBroad304_15348 pLX_304 0% 31.7% 27% V5 (many diffs) n/a
7 TRCN0000473379 GCTTCCGCCGAACCGATGGAGCTC pLX_317 100% 19.8% 19.4% V5 (many diffs) n/a
Download CSV