Transcript: Mouse XM_011238389.1

PREDICTED: Mus musculus staufen (RNA binding protein) homolog 2 (Drosophila) (Stau2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stau2 (29819)
Length:
2658
CDS:
72..1688

Additional Resources:

NCBI RefSeq record:
XM_011238389.1
NBCI Gene record:
Stau2 (29819)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102356 GCCAGGGAACTCCTTATGAAT pLKO.1 1368 CDS 100% 5.625 7.875 N Stau2 n/a
2 TRCN0000157149 GCCAGGGAACTCCTTATGAAT pLKO.1 1368 CDS 100% 5.625 7.875 N STAU2 n/a
3 TRCN0000308892 GCCAGGGAACTCCTTATGAAT pLKO_005 1368 CDS 100% 5.625 7.875 N Stau2 n/a
4 TRCN0000102358 GCAATGAAGTTGCGACTGGAA pLKO.1 1015 CDS 100% 2.640 3.696 N Stau2 n/a
5 TRCN0000308890 GCAATGAAGTTGCGACTGGAA pLKO_005 1015 CDS 100% 2.640 3.696 N Stau2 n/a
6 TRCN0000102357 CCAACCTTCAAGCTCTTTCTT pLKO.1 1310 CDS 100% 5.625 3.938 N Stau2 n/a
7 TRCN0000178809 CCAACCTTCAAGCTCTTTCTT pLKO.1 1310 CDS 100% 5.625 3.938 N STAU2 n/a
8 TRCN0000308893 CCAACCTTCAAGCTCTTTCTT pLKO_005 1310 CDS 100% 5.625 3.938 N Stau2 n/a
9 TRCN0000196026 GCTTCCCAAACCAGTTCAGAA pLKO.1 197 CDS 100% 4.950 3.465 N STAU2 n/a
10 TRCN0000102359 TGGCACAACTCTAAGCTACTT pLKO.1 1271 CDS 100% 4.950 3.465 N Stau2 n/a
11 TRCN0000308811 TGGCACAACTCTAAGCTACTT pLKO_005 1271 CDS 100% 4.950 3.465 N Stau2 n/a
12 TRCN0000153783 CCCAAAGATATGAACCAACCT pLKO.1 1296 CDS 100% 2.640 1.848 N STAU2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08049 pDONR223 100% 91% None (many diffs) n/a
2 ccsbBroad304_08049 pLX_304 0% 91% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481145 GGGAGCCGCTTTGCGACGCCCTTG pLX_317 26.1% 91% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_08050 pDONR223 100% 81.2% 85.3% None (many diffs) n/a
5 ccsbBroad304_08050 pLX_304 0% 81.2% 85.3% V5 (many diffs) n/a
6 TRCN0000467416 TGAACAATCTGTCTGGCTTTCACA pLX_317 21.2% 81.2% 85.3% V5 (many diffs) n/a
7 ccsbBroadEn_11842 pDONR223 100% 18.2% 19.5% None (many diffs) n/a
8 ccsbBroad304_11842 pLX_304 0% 18.2% 19.5% V5 (many diffs) n/a
9 TRCN0000466698 TCGAATGTTGACTGGTGAAGTTAT pLX_317 100% 18.2% 19.5% V5 (many diffs) n/a
Download CSV