Transcript: Mouse XM_011238688.2

PREDICTED: Mus musculus autophagy related 9A (Atg9a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg9a (245860)
Length:
3962
CDS:
380..2899

Additional Resources:

NCBI RefSeq record:
XM_011238688.2
NBCI Gene record:
Atg9a (245860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000179409 CCACCGGCTTATCAAGTTTAT pLKO.1 811 CDS 100% 13.200 9.240 N Atg9a n/a
2 TRCN0000195926 CCGAGTGATTCTTGCACACAT pLKO.1 1693 CDS 100% 4.950 3.465 N Atg9a n/a
3 TRCN0000129286 CTTCCAGTACAAGGCAGTGTT pLKO.1 1783 CDS 100% 4.950 3.465 N ATG9A n/a
4 TRCN0000178945 CCAGGAAGAATATGAGGACTA pLKO.1 3067 3UTR 100% 4.050 2.835 N Atg9a n/a
5 TRCN0000184741 CCTCACTTACCAAGAGGAGAA pLKO.1 3725 3UTR 100% 4.050 2.835 N Atg9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238688.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000471062 AGCTATAACGCCGGTCCCCTTAAC pLX_317 24.3% 58% 52.7% V5 (many diffs) n/a
2 ccsbBroadEn_12539 pDONR223 100% 57.1% 59.8% None (many diffs) n/a
3 ccsbBroad304_12539 pLX_304 0% 57.1% 59.8% V5 (many diffs) n/a
4 TRCN0000481101 AGGGAACGCGCGGTGGCAGAGAAC pLX_317 25% 57.1% 59.8% V5 (many diffs) n/a
Download CSV