Transcript: Mouse XM_011239444.1

PREDICTED: Mus musculus pyruvate dehydrogenase kinase, isoenzyme 1 (Pdk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdk1 (228026)
Length:
5291
CDS:
153..1568

Additional Resources:

NCBI RefSeq record:
XM_011239444.1
NBCI Gene record:
Pdk1 (228026)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011239444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078812 CGGCTTTGTGATTTGTATTAT pLKO.1 969 CDS 100% 15.000 21.000 N Pdk1 n/a
2 TRCN0000334061 CGGCTTTGTGATTTGTATTAT pLKO_005 969 CDS 100% 15.000 21.000 N Pdk1 n/a
3 TRCN0000078811 GCGGCTTTGTGATTTGTATTA pLKO.1 968 CDS 100% 13.200 18.480 N Pdk1 n/a
4 TRCN0000078809 GCCTGTTAGATTGGCAAATAT pLKO.1 401 CDS 100% 15.000 12.000 N Pdk1 n/a
5 TRCN0000334060 GCCTGTTAGATTGGCAAATAT pLKO_005 401 CDS 100% 15.000 12.000 N Pdk1 n/a
6 TRCN0000078810 GCCGAAAGACATGACCACATT pLKO.1 1535 CDS 100% 4.950 3.465 N Pdk1 n/a
7 TRCN0000334131 GCCGAAAGACATGACCACATT pLKO_005 1535 CDS 100% 4.950 3.465 N Pdk1 n/a
8 TRCN0000078808 GCTGAGTATTTCTTTCAAGTT pLKO.1 1822 3UTR 100% 4.950 2.970 N Pdk1 n/a
9 TRCN0000334132 GCTGAGTATTTCTTTCAAGTT pLKO_005 1822 3UTR 100% 4.950 2.970 N Pdk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011239444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01165 pDONR223 100% 79% 84.3% None (many diffs) n/a
2 ccsbBroad304_01165 pLX_304 0% 79% 84.3% V5 (many diffs) n/a
3 TRCN0000479775 CCTTCCAGTTCTCGGGTGCTTTAC pLX_317 11.8% 79% 84.3% V5 (many diffs) n/a
4 ccsbBroadEn_14737 pDONR223 0% 79% 84.3% None (many diffs) n/a
5 ccsbBroad304_14737 pLX_304 0% 79% 84.3% V5 (many diffs) n/a
6 TRCN0000481546 CCGGTGAGACCGACCATTCAGAAA pLX_317 33.8% 79% 84.3% V5 (many diffs) n/a
7 TRCN0000488543 ATACCTAATTACACCCTATCTTTA pLX_317 20.4% 79% 84.3% V5 (many diffs) n/a
8 TRCN0000491614 CTAGCTGAGTGTCGGCTGGCCGCT pLX_317 33.2% 79% 84.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV