Transcript: Mouse XM_011243444.2

PREDICTED: Mus musculus neuropeptide FF receptor 1 (Npffr1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npffr1 (237362)
Length:
4395
CDS:
369..1316

Additional Resources:

NCBI RefSeq record:
XM_011243444.2
NBCI Gene record:
Npffr1 (237362)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011243444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245268 ACGGCTACTTCAACGAGAACT pLKO_005 1009 CDS 100% 4.950 6.930 N Npffr1 n/a
2 TRCN0000363202 ACGGCTACTTCAACGAGAACT pLKO_005 1009 CDS 100% 4.950 6.930 N NPFFR1 n/a
3 TRCN0000009452 CGGCTACTTCAACGAGAACTT pLKO.1 1010 CDS 100% 4.950 6.930 N NPFFR1 n/a
4 TRCN0000245266 ACCCTCGTGGACAACCTTATC pLKO_005 65 5UTR 100% 10.800 7.560 N Npffr1 n/a
5 TRCN0000245267 TGCTCTTCGCGCACATCTATC pLKO_005 673 CDS 100% 10.800 7.560 N Npffr1 n/a
6 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 3679 3UTR 100% 2.640 1.320 Y Adsl n/a
7 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 3679 3UTR 100% 2.640 1.320 Y Adsl n/a
8 TRCN0000182233 CGGTTAAGAACACTGACTGCT pLKO.1 3370 3UTR 100% 2.640 1.320 Y 3110070M22Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011243444.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08834 pDONR223 100% 62.5% 63.1% None (many diffs) n/a
2 ccsbBroad304_08834 pLX_304 0% 62.5% 63.1% V5 (many diffs) n/a
3 TRCN0000476275 TTGTCACTTTTATACGGGTAGATG pLX_317 26.5% 62.5% 63.1% V5 (many diffs) n/a
4 TRCN0000489011 CTAATCTTTTGTAGGGGAGGGGGT pLX_317 16.7% 62.5% 63.1% V5 (many diffs) n/a
5 TRCN0000487701 CCGTGAGCCAAGAATTGAAACCCC pLX_317 18.4% 62.5% 63.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV