Transcript: Mouse XM_011244994.2

PREDICTED: Mus musculus PTK2 protein tyrosine kinase 2 beta (Ptk2b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptk2b (19229)
Length:
3913
CDS:
87..3116

Additional Resources:

NCBI RefSeq record:
XM_011244994.2
NBCI Gene record:
Ptk2b (19229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361441 ATTGAGGACGAAGACTATTAC pLKO_005 1806 CDS 100% 13.200 18.480 N Ptk2b n/a
2 TRCN0000023633 CCTCGTGTACCACAATGTCAT pLKO.1 2720 CDS 100% 4.950 6.930 N Ptk2b n/a
3 TRCN0000023630 GCCTGTCCTTTACACACTCAT pLKO.1 2039 CDS 100% 4.950 6.930 N Ptk2b n/a
4 TRCN0000023632 GCTGACAAGTCAAGATACAAA pLKO.1 950 CDS 100% 5.625 4.500 N Ptk2b n/a
5 TRCN0000023631 CCTCAGTGACATTTATCAGAT pLKO.1 2120 CDS 100% 4.950 3.960 N Ptk2b n/a
6 TRCN0000361378 ACACTACCTGGAACGAAATAA pLKO_005 1619 CDS 100% 15.000 10.500 N Ptk2b n/a
7 TRCN0000361440 ATCATGGAACTGTATCCTTAT pLKO_005 1587 CDS 100% 10.800 7.560 N Ptk2b n/a
8 TRCN0000361379 ATGCTTGGACCCTATGGTTTA pLKO_005 2567 CDS 100% 10.800 7.560 N Ptk2b n/a
9 TRCN0000195241 CATTCAAGGATGGAACATTAC pLKO.1 893 CDS 100% 10.800 7.560 N PTK2B n/a
10 TRCN0000023629 CCAACTTTGAACTCCTGGAAA pLKO.1 682 CDS 100% 4.950 3.465 N Ptk2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244994.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489846 CACTGTCACTTCCGTACACGCGCC pLX_317 12.9% 89.2% 95.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_14635 pDONR223 0% 89.2% 95.4% None (many diffs) n/a
3 ccsbBroad304_14635 pLX_304 0% 89.2% 95.4% V5 (many diffs) n/a
4 TRCN0000480167 TTGGATCGGCTGCCGTGCACAATT pLX_317 12.8% 89.2% 95.3% V5 (many diffs) n/a
5 TRCN0000472345 TTCCCCCAATCCGGTCCGTAGCTT pLX_317 9.5% 89.2% 95.3% V5 (many diffs) n/a
6 TRCN0000489596 CGTATTCTTTATGGATGTCTAACC pLX_317 13.6% 89.2% 95.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV