Transcript: Mouse XM_011247040.2

PREDICTED: Mus musculus bromodomain containing 8 (Brd8), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brd8 (78656)
Length:
4836
CDS:
93..2528

Additional Resources:

NCBI RefSeq record:
XM_011247040.2
NBCI Gene record:
Brd8 (78656)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096645 CGTGACATCATGCTGATGTTT pLKO.1 2202 CDS 100% 0.563 0.788 N Brd8 n/a
2 TRCN0000096646 GCCTATGGATTTGTCAACTAT pLKO.1 2132 CDS 100% 5.625 4.500 N Brd8 n/a
3 TRCN0000301665 GCCTATGGATTTGTCAACTAT pLKO_005 2132 CDS 100% 5.625 4.500 N Brd8 n/a
4 TRCN0000304391 GGATCAAGGAGAAGGCTATTT pLKO_005 1826 CDS 100% 13.200 9.240 N Brd8 n/a
5 TRCN0000304392 TAGCGGAGAAGATGGATATTG pLKO_005 1069 CDS 100% 13.200 9.240 N Brd8 n/a
6 TRCN0000096648 GAAGATGTTATTGTTCGCAAA pLKO.1 369 CDS 100% 4.050 2.835 N Brd8 n/a
7 TRCN0000096647 GCTGAGATAGTAGCTGGAGTT pLKO.1 1446 CDS 100% 4.050 2.835 N Brd8 n/a
8 TRCN0000301664 GCTGAGATAGTAGCTGGAGTT pLKO_005 1446 CDS 100% 4.050 2.835 N Brd8 n/a
9 TRCN0000222187 GCTGTGTCTTACACAGGTGAA pLKO.1 1089 CDS 100% 0.405 0.284 N BRD8 n/a
10 TRCN0000096644 CCACACTTGATCTTAGTCAAA pLKO.1 4551 3UTR 100% 4.950 2.475 Y Brd8 n/a
11 TRCN0000301663 CCACACTTGATCTTAGTCAAA pLKO_005 4551 3UTR 100% 4.950 2.475 Y Brd8 n/a
12 TRCN0000229928 CTATGGATTTGTCAACTATTA pLKO_005 2134 CDS 100% 13.200 9.240 N BRD8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487955 ATTGGCGTGTGCGCATAAAGAAGG pLX_317 7.3% 75% 77.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_11567 pDONR223 100% 72.1% 74.7% None (many diffs) n/a
3 ccsbBroad304_11567 pLX_304 0% 72.1% 74.7% V5 (many diffs) n/a
4 TRCN0000472489 ACAACACATTCTTTTCTCCGTATC pLX_317 5.6% 72.1% 74.7% V5 (many diffs) n/a
Download CSV