Transcript: Mouse XM_011247435.2

PREDICTED: Mus musculus calcium/calmodulin-dependent serine protein kinase (MAGUK family) (Cask), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cask (12361)
Length:
6201
CDS:
718..3600

Additional Resources:

NCBI RefSeq record:
XM_011247435.2
NBCI Gene record:
Cask (12361)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024261 GCGAAGGAACTAAAGCGTATT pLKO.1 2008 CDS 100% 10.800 15.120 N Cask n/a
2 TRCN0000321825 GCGAAGGAACTAAAGCGTATT pLKO_005 2008 CDS 100% 10.800 15.120 N Cask n/a
3 TRCN0000024263 GCGAGGGAGTATTACCTTCAA pLKO.1 2412 CDS 100% 4.950 6.930 N Cask n/a
4 TRCN0000321826 GCGAGGGAGTATTACCTTCAA pLKO_005 2412 CDS 100% 4.950 6.930 N Cask n/a
5 TRCN0000197068 GCGTACCCTATTCCACATACA pLKO.1 3001 CDS 100% 4.950 6.930 N CASK n/a
6 TRCN0000321830 CTGCGCTACTGTCATGATAAT pLKO_005 1120 CDS 100% 13.200 10.560 N Cask n/a
7 TRCN0000321829 CCTTGGCTATCTGAGTATAAA pLKO_005 3607 3UTR 100% 15.000 10.500 N Cask n/a
8 TRCN0000196604 GCTGAAAGGATCACTGTTTAT pLKO.1 1519 CDS 100% 13.200 9.240 N CASK n/a
9 TRCN0000195064 CCGAATAGATAGGAGGAGAAA pLKO.1 3747 3UTR 100% 4.950 3.465 N CASK n/a
10 TRCN0000342340 CCGAATAGATAGGAGGAGAAA pLKO_005 3747 3UTR 100% 4.950 3.465 N CASK n/a
11 TRCN0000024260 CGGCGATGTATCAACAGAGAA pLKO.1 796 CDS 100% 4.950 3.465 N Cask n/a
12 TRCN0000321824 CGGCGATGTATCAACAGAGAA pLKO_005 796 CDS 100% 4.950 3.465 N Cask n/a
13 TRCN0000024259 GCCAACTATCACTCCAGGTTT pLKO.1 3396 CDS 100% 4.950 3.465 N Cask n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6159 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247435.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01960 pDONR223 100% 88.6% 92.5% None (many diffs) n/a
2 ccsbBroad304_01960 pLX_304 0% 88.6% 92.5% V5 (many diffs) n/a
3 ccsbBroadEn_14906 pDONR223 60.4% 88.2% 24.3% None (many diffs) n/a
4 ccsbBroad304_14906 pLX_304 0% 88.2% 24.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000474787 ATATACCGGGATTACACATCTTGC pLX_317 16.7% 88.2% 24.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV