Transcript: Mouse XM_011249305.2

PREDICTED: Mus musculus musashi RNA-binding protein 2 (Msi2), transcript variant X16, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msi2 (76626)
Length:
6288
CDS:
169..978

Additional Resources:

NCBI RefSeq record:
XM_011249305.2
NBCI Gene record:
Msi2 (76626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071973 CCCAGCTTAATATCTAGTTAA pLKO.1 1335 3UTR 100% 13.200 18.480 N Msi2 n/a
2 TRCN0000324753 CCCAGCTTAATATCTAGTTAA pLKO_005 1335 3UTR 100% 13.200 18.480 N Msi2 n/a
3 TRCN0000071975 CGTAGGAGGATTGTCTGCAAA pLKO.1 252 CDS 100% 4.950 6.930 N Msi2 n/a
4 TRCN0000324751 CGTAGGAGGATTGTCTGCAAA pLKO_005 252 CDS 100% 4.950 6.930 N Msi2 n/a
5 TRCN0000426366 CTTTGATTGCAACGGCCTTTA pLKO_005 941 CDS 100% 10.800 7.560 N MSI2 n/a
6 TRCN0000071974 CCCAACTTTGTGGCAACCTAT pLKO.1 571 CDS 100% 4.950 3.465 N Msi2 n/a
7 TRCN0000324685 CCCAACTTTGTGGCAACCTAT pLKO_005 571 CDS 100% 4.950 3.465 N Msi2 n/a
8 TRCN0000071976 GCTACAGTGCTCAACCGAATT pLKO.1 737 CDS 100% 0.000 0.000 N Msi2 n/a
9 TRCN0000353948 GCTACAGTGCTCAACCGAATT pLKO_005 737 CDS 100% 0.000 0.000 N Msi2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249305.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09483 pDONR223 100% 63.5% 61.9% None (many diffs) n/a
2 ccsbBroad304_09483 pLX_304 0% 63.5% 61.9% V5 (many diffs) n/a
3 TRCN0000465338 GATCTCGCCGAGCCAAACTTGCCT pLX_317 29.5% 63.5% 61.9% V5 (many diffs) n/a
4 ccsbBroadEn_13107 pDONR223 100% 49.6% 51.2% None (many diffs) n/a
5 ccsbBroad304_13107 pLX_304 0% 49.6% 51.2% V5 (many diffs) n/a
6 TRCN0000468295 CTGACGCTGTAATCCCGACCACGA pLX_317 77.8% 49.6% 51.2% V5 (many diffs) n/a
Download CSV