Transcript: Mouse XM_011249734.2

PREDICTED: Mus musculus hedgehog interacting protein-like 2 (Hhipl2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hhipl2 (78772)
Length:
3410
CDS:
1162..3081

Additional Resources:

NCBI RefSeq record:
XM_011249734.2
NBCI Gene record:
Hhipl2 (78772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184709 CCAACGCAACCTTCACTTCTA pLKO.1 2864 CDS 100% 4.950 6.930 N Hhipl2 n/a
2 TRCN0000216760 GACAAGAGACTTTGCCGTAAT pLKO.1 2344 CDS 100% 10.800 8.640 N Hhipl2 n/a
3 TRCN0000182970 CAACCGCAAGTTCTACATTTA pLKO.1 1761 CDS 100% 13.200 9.240 N Hhipl2 n/a
4 TRCN0000183464 GCCACATGGATCTATTTACAA pLKO.1 2688 CDS 100% 5.625 3.938 N Hhipl2 n/a
5 TRCN0000183274 GAAATCTTGCTGTCTACTGAA pLKO.1 3229 3UTR 100% 4.950 3.465 N Hhipl2 n/a
6 TRCN0000179317 GAGTGCATAATGCTGTCCATT pLKO.1 3132 3UTR 100% 4.950 3.465 N Hhipl2 n/a
7 TRCN0000195790 CCTGGGAAATCTTGCTGTCTA pLKO.1 3224 3UTR 100% 4.950 2.970 N Hhipl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12619 pDONR223 100% 68.6% 67.7% None (many diffs) n/a
2 ccsbBroad304_12619 pLX_304 0% 68.6% 67.7% V5 (many diffs) n/a
3 TRCN0000465288 TCGGGGTTTTAGCGGAATGCCGCG pLX_317 22.8% 68.6% 67.7% V5 (many diffs) n/a
4 ccsbBroadEn_15991 pDONR223 0% 34.8% 35.6% None (many diffs) n/a
5 ccsbBroad304_15991 pLX_304 0% 34.8% 35.6% V5 (many diffs) n/a
6 TRCN0000473771 TACTACAGACAATTCTCGAACTGT pLX_317 71.7% 34.8% 35.6% V5 (many diffs) n/a
Download CSV