Transcript: Human XM_011509538.3

PREDICTED: Homo sapiens LIM homeobox transcription factor 1 alpha (LMX1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LMX1A (4009)
Length:
3014
CDS:
93..1001

Additional Resources:

NCBI RefSeq record:
XM_011509538.3
NBCI Gene record:
LMX1A (4009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011509538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427670 AGTGTGTAACCTTTCGTATTT pLKO_005 1408 3UTR 100% 13.200 18.480 N LMX1A n/a
2 TRCN0000433282 CATTATGGATTGCATAGTTTA pLKO_005 1175 3UTR 100% 13.200 10.560 N Lmx1a n/a
3 TRCN0000017213 CCCATATGGAACAACCATATT pLKO.1 1031 3UTR 100% 0.000 0.000 N LMX1A n/a
4 TRCN0000017216 GCAGCCTCAGACTCAGGTAAA pLKO.1 333 CDS 100% 10.800 7.560 N LMX1A n/a
5 TRCN0000017217 CAGAGTGTCTACAGCTCAGAT pLKO.1 762 CDS 100% 4.950 3.465 N LMX1A n/a
6 TRCN0000017215 CCCTCAGTAACCTGGGTGATT pLKO.1 883 CDS 100% 4.950 3.465 N LMX1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011509538.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10949 pDONR223 100% 33% 33.1% None 1_606del;810T>C n/a
2 ccsbBroad304_10949 pLX_304 0% 33% 33.1% V5 1_606del;810T>C n/a
3 TRCN0000469744 TAAGCACAGCGCGGATGTGGCCCA pLX_317 100% 33% 33.1% V5 1_606del;810T>C n/a
Download CSV