Transcript: Human XM_011515566.1

PREDICTED: Homo sapiens zinc finger MIZ-type containing 2 (ZMIZ2), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMIZ2 (83637)
Length:
4335
CDS:
110..2077

Additional Resources:

NCBI RefSeq record:
XM_011515566.1
NBCI Gene record:
ZMIZ2 (83637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011515566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108196 CATCACCAAGATAAAGCGGAA pLKO.1 1006 CDS 100% 2.160 3.024 N ZMIZ2 n/a
2 TRCN0000108197 AGTCTACAAGACCCTGATAAT pLKO.1 676 CDS 100% 13.200 10.560 N ZMIZ2 n/a
3 TRCN0000310841 GTCATGACTGTCGCCACATAC pLKO_005 1152 CDS 100% 10.800 7.560 N ZMIZ2 n/a
4 TRCN0000108199 GACCTCCCTACGAACAACAAT pLKO.1 2024 CDS 100% 5.625 3.938 N ZMIZ2 n/a
5 TRCN0000300961 GACCTCCCTACGAACAACAAT pLKO_005 2024 CDS 100% 5.625 3.938 N ZMIZ2 n/a
6 TRCN0000095243 CACCAAGATAAAGCGGAACTT pLKO.1 1009 CDS 100% 4.950 3.465 N Zmiz2 n/a
7 TRCN0000108195 CCAGCATTGATCCTTCTGTTT pLKO.1 2451 3UTR 100% 4.950 3.465 N ZMIZ2 n/a
8 TRCN0000300963 CCAGCATTGATCCTTCTGTTT pLKO_005 2451 3UTR 100% 4.950 3.465 N ZMIZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011515566.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12750 pDONR223 100% 70.6% 67% None (many diffs) n/a
2 ccsbBroad304_12750 pLX_304 0% 70.6% 67% V5 (many diffs) n/a
3 TRCN0000478264 ATTATTTTCCTTCCACATTTACAT pLX_317 12.3% 70.6% 67% V5 (many diffs) n/a
4 ccsbBroadEn_16021 pDONR223 0% 67.4% 67.4% None 1_639del n/a
5 TRCN0000492079 ACAACGCACGCCTTATCGCACCTA pLX_317 23.8% 67.4% 67.4% V5 1_639del n/a
Download CSV